Labshake search
Citations for GenScript :
301 - 350 of 1178 citations for Human Immunodeficiency Virus GP41 Protein HIV 1 Clade B since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... or PAGE-MASTER Protein Standard Plus (GenScript), 5 μL in both cases ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli protein expression and synthesized by GenScript, USA before being cloned into the pETDuet-1 vector ...
-
bioRxiv - Immunology 2023Quote: Recombinant SFB3340 protein was procured from GenScript, biotinylated at 1:1 ratio using EZ-Link™ Sulfo-NHS-LC-Biotin (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: All proteins were custom-made by GenScript HK Limited ...
-
bioRxiv - Developmental Biology 2021Quote: ... flanked by duplicated copies of the 250bp chick B-globin HS4 insulator (Allen and Weeks, 2005; Rankin et al 2011) was commercially synthesized (Genscript USA) and cloned into the ApaI/XhoI sites of pBluescript II KS+ (Agilent 212207) ...
-
bioRxiv - Immunology 2019Quote: ... splenocytes from Pmel were isolated and culture with 1µM human gp100 (hgp100) (Genscript) and 30 IU/mL recombinant human IL-2 (PeproTech Inc ...
-
bioRxiv - Biochemistry 2021Quote: The human Sgk3 gene was codon optimized for expression in insect cells (Genscript) and fused to the C-terminus of His10/StrepII-tagged eGFP (A206K monomeric variant ...
-
bioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP) labeled-mouse anti-human IgG-Fc specific (GenScript No. A01854) diluted 1:10,000 in PBST was added (100μl/well ...
-
bioRxiv - Immunology 2021Quote: ... the variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
bioRxiv - Biochemistry 2023Quote: The human abhd14b gene22 was synthesized as a codon-optimized construct (from Genscript) for expression in E ...
-
bioRxiv - Biophysics 2023Quote: ... DNA human WNK3 (118-409) was subcloned into a pET29b vector by Genscript Inc ...
-
bioRxiv - Molecular Biology 2023Quote: ... a plasmid with the human NSMCE2 cDNA was purchased from GenScript (cat # Ohu31586D). The NSMCE2 coding sequence was PCR-amplified to add a Kozak consensus sequence for efficient initiation of translation and flanking KpnI and XhoI restriction sites ...
-
bioRxiv - Biophysics 2023Quote: ... human/mouse codon-optimized genes coding for the identified ChRs were ordered (GenScript, Piscataway ...
-
bioRxiv - Cell Biology 2024Quote: ... the codon-optimized gene containing full-length human SNX27 was synthesized by GenScript® and cloned into pET28a vector as described previously (30) ...
-
bioRxiv - Cell Biology 2020Quote: The endotoxin level of FHL-1 recombinant protein preparations was measured using the Toxin Sensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, NJ, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... BG505 SOSIP.v4.1 expression constructs in which all PNGS were mutated to either NxT (NxT protein) or NxS (NxS protein) were obtained from Genscript and cloned in the pPPI4 expression vector ...
-
bioRxiv - Cell Biology 2021Quote: ... The anti-Mps1 antibodies were generated in rabbits against a recombinant Mps1 protein fragment (residues 440-764) of the protein by Genscript. The company provided affinity purified antibodies that we validated by purifying kinetochores from yeast strains with Mps1 or Mps1-13Myc and confirming that the antibody recognized a protein of the correct molecular weight that migrated more slowly with the 13Myc epitope tags ...
-
bioRxiv - Neuroscience 2021Quote: ... An ELISA titer of over 1:128,000 and target protein binding were validated by immunoprecipitation and western blotting using the positive control with protein immunogen by GenScript. The final product was 0.5 ml of pre-immune serum at 1.5-6 mg/rabbit and 1 mg of the requested peptide.
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag-171Yb (clone HPC4, Genscript), anti-mCherry-142Nd (Abcam) ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag-171Yb (clone HPC4, Genscript), anti-mCherry-142Nd (Abcam) ...
-
bioRxiv - Biochemistry 2020Quote: ... and 0.2 mg/mL Protein C peptide (Genscript), and concentrated on a Vivaspin 50-kDa concentrator.
-
bioRxiv - Molecular Biology 2022Quote: ... All custom recombinant proteins were synthesised by GenScript using a mammalian expression system.
-
bioRxiv - Molecular Biology 2021Quote: ... Purified FMO-2 protein was purchased from GenScript. Purified FMO5 protein ...
-
bioRxiv - Microbiology 2021Quote: ... eBlot L1 –Fast Wet Protein Transfer System (GenScript) was used for blotting and proteins were stained using the following antibodies ...
-
bioRxiv - Immunology 2019Quote: Recombinant microbial protein synthesis was performed by Genscript Corporation (http://www.genscript.com/ ...
-
bioRxiv - Microbiology 2019Quote: ... and incubated with recombinant protein (GenScript, Sigma, Tocris) of each analyte for 4 h at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... the proteins were transferred to nitrocellulose membrane (Genscript) by the Genscript eBLOT L1 fast wet protein transfer system ...
-
bioRxiv - Microbiology 2020Quote: ... The protein was cleaved using bovine enterokinase (GenScript) leaving a FLAG-tag at the C-terminus of the RBD ...
-
bioRxiv - Immunology 2022Quote: ... or S-protein peptide pool (Genscript, # RP30020, USA) or S-protein (B.1.351 ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were resolved on 4%-12% (GenScript, M00654) or 4%-20% (GenScript ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 Spike RBD protein (GenScript #Z03479) was immobilized on high-absorbency 96-well plates at 5 ng/mL and incubated at 4°C overnight ...
-
bioRxiv - Immunology 2023Quote: ... Protein A/G beads (Genscript, Nanjing, Jiangsu, China) were subsequently added to the mixtures and incubated for another 5 h ...
-
bioRxiv - Biochemistry 2023Quote: ... before incubation with Protein A Resin (Genscript, China) at room temperature for 2 h for antibody affinity purification ...
-
bioRxiv - Biochemistry 2024Quote: Plasmids for protein expression were ordered from Genscript (gene synthesis ...
-
bioRxiv - Biophysics 2020Quote: ... LC3C/B) and the GFP-tagged double mutants (GFP-LC3A-EE, GFP-LC3B-AK) were obtained by subcloning (synthesized by GenScript, Piscataway, NJ).
-
bioRxiv - Molecular Biology 2020Quote: ... (referred to as eRF3 in the text) was made by inserting DNA between BglII and Nde1 sites of pET23(b) (GenScript, Piscataway, NJ).
-
bioRxiv - Bioengineering 2019Quote: ... and acetyl-CoA acetyltransferase/pyrophosphorylase (glmU, a homologue of gcaD in B. subtilis) were codon-optimized for Syn7002 and synthesized by GenScript (Hong Kong). The expression of both HA synthase genes was controlled by an IPTG inducible promotor ...
-
bioRxiv - Physiology 2023Quote: ... VHA was immunodetected using custom-made rabbit polyclonal antibodies against a highly conserved epitope within subunit B (epitope: AREEVPGRRGFPGY; GenScript, Piscataway, USA). Both NKA and VHA antibodies have been validated in the inner ear of splitnose rockfish (24 ...
-
bioRxiv - Microbiology 2020Quote: ... The cDNA for SARS-CoV-2 Spike protein ectodomain residues 1 to 1220 (S-Ectodomain-GFP) was chemically synthesized with optimal insect cell codons (Genscript USA Inc, NJ, USA) and cloned into pVL1393 (Expression Systems ...
-
bioRxiv - Immunology 2021Quote: ... Antigens included recombinant SARS-CoV−2 RBD protein obtained from the Saphire laboratory at LJI or recombinant nucleocapsid protein (GenScript Z03488). The next day ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to measure total protein content to enable equal loading of protein onto 4-12% precast mini polyacrylamide gels (SurePAGE™, GenScript). Proteins were transferred onto polyvinyl difluoride (PVDF ...
-
bioRxiv - Molecular Biology 2019Quote: The human AQP7 gene (Uniprot ID O14520) was codon-optimized and synthesized from GenScript, China ...
-
bioRxiv - Biochemistry 2020Quote: The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC ...
-
bioRxiv - Cancer Biology 2022Quote: The cloning service of recombinant human HK1b and HK1c isoforms was performed by GenScript Inc (Piscataway ...
-
bioRxiv - Biochemistry 2021Quote: ... codon optimized human DHFR was produced as a 6His-SUMO1 fusion from pET28a (Genscript).
-
bioRxiv - Immunology 2021Quote: ... Media supplemented with 10 ng/mL of recombinant human VEGF (GenScript, Piscataway, NJ, U.S.) was used as a positive control ...
-
bioRxiv - Immunology 2020Quote: ... human recombinant IL-2 (10 U/well) and with or without SIINFEKL peptide (Genscript) at 0.2ug/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... the DNA coding for the human LRRK1 residues 20 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCGCTGTGTGTCCAGAACGTGCCATGG and the reverse primer TATCCACCTTTACTGTCACCTTCTCTTGCGAGTGCAAGCCTCC ...
-
bioRxiv - Biophysics 2022Quote: The full length human PARP1 cDNA cloned in pET28-a(+) was purchased from GenScript, USA ...
-
bioRxiv - Biochemistry 2022Quote: A codon-optimized open reading frame for Human DSS1 (DSS1) was synthesized (GenScript Inc.) with a SUMO protease cleavable N-terminal MVKIH-Strep-6x-HIS-SUMO tag ...