Labshake search
Citations for GenScript :
301 - 350 of 701 citations for Human GSDMC shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... The pCCL-WSB1 and pCCL-c-Myc plasmids were purchased from Genscript, and were re-constructed to pCDH vector with N-terminal FLAG tag ...
-
bioRxiv - Microbiology 2022Quote: ... plasmids containing systems with these deletions/mutations were commercially synthesized by Genscript. The mutated systems were transformed into B ...
-
bioRxiv - Cell Biology 2022Quote: ... the plasmid construct with the mouse Ch25h gene in pcDNA3.1 (Genscript, OMu18523D) was used to define the standard curve ...
-
bioRxiv - Biochemistry 2021Quote: ... plasmid with the codon-optimized synthetic DNA sequences (GenScript, Piscataway, NJ, USA) coding for HCV nsp5b RdRp (CAB46677.1 polyprotein ...
-
bioRxiv - Cell Biology 2020Quote: ... The gRNA was cloned into the pGS-U6-gRNA plasmids by Genscript® ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... restriction enzymes) was synthesized into a pUC57 plasmid DNA vector by Genscript®.
-
bioRxiv - Molecular Biology 2022Quote: ... mLimch1 and uLimch1 epitope tagged expression plasmids were commercially synthesized by GenScript. A Myc tag was included in the C-terminus region of the uLimch1 sequence ...
-
bioRxiv - Biochemistry 2022Quote: ... synthesized and cloned into the pUC57 plasmid (high copy AmpR) by GenScript Biotech ...
-
bioRxiv - Neuroscience 2023Quote: ... an expression plasmid of pcDNA3.1(+)-SCN10A-Furin-P2A-SCN2B was constructed (Genscript) in which a CMV promoter transcribes human NaV1.8α and Na²2 from a single open reading frame (ORF ...
-
bioRxiv - Immunology 2023Quote: ... Mid1 and YAP1 Crispr/Cas9 knockout transfer plasmid were purchased from GenScript; For Erdr1 overexpression ...
-
bioRxiv - Cell Biology 2024Quote: ... PPTC7-1_pLentiCRISPR V2 and PPTC7-2_pLentiCRISPR V2 plasmids were generated by Genscript® based on the the following gRNA sequences ...
-
bioRxiv - Bioengineering 2024Quote: ... and sequenced the same as the GD2-CAR plasmid (Genscript, Piscataway, NJ). Both transgenes were flanked by 500 bp homology arms and cloned into a pUC57 backbone ...
-
bioRxiv - Biophysics 2024Quote: ... pGEX-MgtA dimer (12mer) plasmids were de novo gene synthesized by GenScript. Plasmids created in this study were assembled using the Gibson Assembly Cloning Kit (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2024Quote: PPARα-A plasmid encoding the STREP-PPARα LBD was ordered from GenScript. A sequence encoding for the human PPARα LBD (residue 200-468 ...
-
bioRxiv - Molecular Biology 2019Quote: The human AQP7 gene (Uniprot ID O14520) was codon-optimized and synthesized from GenScript, China ...
-
bioRxiv - Biochemistry 2020Quote: The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC ...
-
bioRxiv - Cancer Biology 2022Quote: The cloning service of recombinant human HK1b and HK1c isoforms was performed by GenScript Inc (Piscataway ...
-
bioRxiv - Biochemistry 2021Quote: ... codon optimized human DHFR was produced as a 6His-SUMO1 fusion from pET28a (Genscript).
-
bioRxiv - Immunology 2021Quote: ... Media supplemented with 10 ng/mL of recombinant human VEGF (GenScript, Piscataway, NJ, U.S.) was used as a positive control ...
-
bioRxiv - Immunology 2020Quote: ... human recombinant IL-2 (10 U/well) and with or without SIINFEKL peptide (Genscript) at 0.2ug/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... the DNA coding for the human LRRK1 residues 20 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCGCTGTGTGTCCAGAACGTGCCATGG and the reverse primer TATCCACCTTTACTGTCACCTTCTCTTGCGAGTGCAAGCCTCC ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Biophysics 2022Quote: The full length human PARP1 cDNA cloned in pET28-a(+) was purchased from GenScript, USA ...
-
bioRxiv - Biochemistry 2022Quote: A codon-optimized open reading frame for Human DSS1 (DSS1) was synthesized (GenScript Inc.) with a SUMO protease cleavable N-terminal MVKIH-Strep-6x-HIS-SUMO tag ...
-
bioRxiv - Immunology 2022Quote: ... the four genes for each multispecific antibody were synthesized using human preferred codons (GenScript) and cloned into eukaryotic expression vectors ...
-
bioRxiv - Biophysics 2023Quote: The γ1 ORF (human ortholog LRRC26) used in this study was obtained from Genscript database and tagged on the C-terminus with 3C protease ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Biochemistry 2023Quote: Human Mint1 open reading frame and mutant Mint1(D269A/I270A) were obtained from Genscript and cloned into the pcDNA3.1-N-eGFP ...
-
Mammalian-unique eIF4E2 maintains GSK3β proline kinase activity to resist senescence against hypoxiabioRxiv - Cell Biology 2020Quote: ... HCT116 cells were cotransfected with plasmid pX330 and cas9 Nuclease (GenScript, Z03386-50) containing sgRNAs targeting exon 7 of eIF4E2-201 ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using polyethylenimine (PEI ...
-
bioRxiv - Bioengineering 2020Quote: Plasmids encoding cDNAs for the heavy chain of IgG were purchased from Genscript and cloned into the pFUSE-CHIg-hG1 vector (Invivogen) ...
-
bioRxiv - Microbiology 2019Quote: ... and 1 µg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Neuroscience 2022Quote: ... and Shisa7 (NM_001145176.2; pIRES2-EGFP) plasmids were generated by Genscript (GenScript, Piscataway, NJ). pIRES2-EGFP vector was a gift from Dr ...
-
bioRxiv - Cancer Biology 2022Quote: ... pcDNA3.1 plasmids with the according constructs were purchased from GenScript (Leiden, The Netherlands). Transfection with Attractene (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmids for the other 16 TTSPs and furin were purchased from GenScript and described earlier (13) ...
-
bioRxiv - Evolutionary Biology 2022Quote: All inserts were synthesized and cloned into the plasmids by GenScript (NJ, USA).
-
bioRxiv - Systems Biology 2022Quote: ... we used CRISPR-mediated homology-directed repair with donor plasmid synthesized by Genscript. gRNA was designed using the target finder tool from flyCRISPR (https://flycrispr.org) ...
-
bioRxiv - Genetics 2022Quote: ... DNA plasmids co-express variant and WT KCNH2 allele were ordered from GenScript Inc (Pistcataway ...
-
bioRxiv - Neuroscience 2019Quote: The AAV-PHP.eB Rep-Cap trans plasmid was generated by gene synthesis (GenScript). AAV9 ...
-
bioRxiv - Immunology 2020Quote: ... The plasmid encoding for SARS-CoV-2 S RBD was synthesized commercially (Genscript). The RBD sequence (encoding for residues 319-541 ...
-
bioRxiv - Plant Biology 2023Quote: The series of truncated ONSEN RT plasmids were created from a synthesized (GenScript) ONSEN-ALS cassette cloned into pUC57 ...
-
bioRxiv - Evolutionary Biology 2022Quote: All inserts were synthesized and cloned into the plasmids by GenScript (NJ, USA).
-
bioRxiv - Biochemistry 2023Quote: ... The WT-AGO2-GFP and NES-AGO2-GFP plasmids were generated by GenScript. A classic leucine-rich nuclear export signal (NES) ...
-
bioRxiv - Bioengineering 2023Quote: ... A pET29b expression plasmid encoding I53-50B.4PT1 16 was synthesized by GenScript using the NdeI and XhoI restriction sites with a double stop codon just before the C-terminal polyhistidine tag ...
-
bioRxiv - Immunology 2023Quote: ... and 1 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Microbiology 2023Quote: Sequential site-directed mutagenesis was performed using wild-type ALKBH1 plasmid (OHu05179, GenScript) as a template with the following primer pairs ...
-
bioRxiv - Cell Biology 2023Quote: ... Both plasmid cloning and BacMam virus generation were done by GenScript (Nanjing, China).
-
bioRxiv - Molecular Biology 2023Quote: ... All no-m6A-ftz reporters were synthesized and inserted in pUC57 plasmids (Genscript), subcloned using HindIII and SmaI sites and inserted into pcDNA3.0 or pcDNA3.1 (V5-His ...
-
bioRxiv - Immunology 2022Quote: Both Ixodes IRE1α and TRAF2 were codon optimized for expression in human cell lines (GenScript). Primers listed in Supplemental Table 1 were used to amplify full length I ...