Labshake search
Citations for GenScript :
301 - 350 of 524 citations for Crimean Congo Haemorrhagic Fever virus CCHFV glycoprotein C Gc sheep Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The plasmid encoding Wag31 with an N-terminal 6xHis tag followed by a TEV protease cleavage site (pET-His-TEV-Wag31) was synthesized by Genscript. The Wag31 N-terminal DivIVA domain (Wag311-61 ...
-
bioRxiv - Biophysics 2023Quote: ... The chimera VnE-PRM-Prof with an N-terminal twinned-Strep-Tag (ST2) and PreScission-cleavage-site (ST2-(PreScission-cleavage-site)-VnE-PRM-Prof) was cloned by Genscript. The VnE-PRM-Prof chimera was designed to ...
-
bioRxiv - Biochemistry 2023Quote: ... wild-type APE1 was expressed in the absence of any tags from a pet28a codon optimized clone purchased from GenScript. The plasmid was transformed into One Shot BL21(DE3)plysS E ...
-
bioRxiv - Biochemistry 2023Quote: ... vector encoding WT DosS CA (amino acids 454 – 578 of full-length DosS) sequence with an N-terminal 6xHis tag and a TEV protease site was purchased from GenScript. DosS CA mutants were prepared from the WT plasmid via site-directed mutagenesis with end-to-end primers similar to methods described in previous papers.22 The forward and reverse primers (5’ to 3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... NM_003755) with an N-terminal His6 tag was made by inserting DNA between NdeI and XhoI sites of pET15b (GenScript). pET15b-His6-eIF3g was used by GenScript to generate the deletion and substitution mutants.
-
bioRxiv - Immunology 2023Quote: ... backbone and cDNA sequences for human NINJ1 (UniProtKB Q92982) or NINJ2 (UniProtKB Q9NZG7) protein with an N-terminal 3xFLAG tag and GSG linker were ordered from Genscript. For protein expression ...
-
bioRxiv - Biophysics 2023Quote: The plasmid harboring wild-type Tsa1 (pET19b-Tsa1) was originally obtained with an amino-terminal deca-histidine-tag in a codon-optimized manner from GenScript (kind gift from P.O ...
-
bioRxiv - Immunology 2023Quote: Genes coding for SARS-CoV-2 Spike (S) ectodomains (Hu-1 and BA.1) with Hisx8 and Strep tags were synthesized by Genscript and cloned into the pcDNA3.1(+ ...
-
bioRxiv - Biophysics 2023Quote: The plasmids for the expression of codon optimized versions of G4Ps and variants with N-terminal FLAG-His tags in the pET28a backbone were synthesized by GenScript.
-
bioRxiv - Microbiology 2023Quote: ... A recodonized version of full-length PfPK2 with at AvrII and StuI sites upstream of a loxP sequence in frame with GFP tag was custom synthesized as a G-block (Genscript). The resulting plasmid DNA construct (pSLI-PfPK2-loxP ...
-
bioRxiv - Biochemistry 2023Quote: The recombinant PLpro wild type and mutants’ genes with an N-terminal Hisx6 tag was introduced into the pET-28b (+) bacterial expression vector by GenScript, Inc ...
-
bioRxiv - Cell Biology 2024Quote: ... and eluted from the column by incubation with either reduced glutathione (to retain the GST tag) or with 10 units Prescission Protease (Genscript) to obtain protein without a tag ...
-
bioRxiv - Biochemistry 2024Quote: ... Equivalent aliquots (15 µL) of each fraction were analysed by SDS-PAGE and immunoblotting using anti-His tag antibody (GenScript) overnight at 4°C as per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Biochemistry 2024Quote: ... fused to consecutive C-terminal HA (hemagglutinin)- and FLAG-tags and cloned into pCDNA-3.1 plasmid for expression in HEK293 cells by the CMV (cytomegalovirus) promoter (GenScript Biotech). Mutant variants were generated by site directed mutagenesis (GenScript Biotech).
-
bioRxiv - Biophysics 2024Quote: ... or C154Y mutants optimized for expression in yeast were cloned in a pPIC9K vector upstream of a sequence coding for a PreScission protease cleavage site (LEVLFQGP) followed by a linker of 11 amino acids and a 10His tag (GenScript). The plasmids were introduced in Pichia pastoris strain SMD1163 (his4 ...
-
bioRxiv - Biophysics 2024Quote: ... A pET28a(+) plasmid containing an open reading frame for human hnRNPA1 with an N-terminal 6xHis tag was synthesized by GenScript. The 6xHis-hnRNPA1 was expressed in E ...
-
bioRxiv - Molecular Biology 2023Quote: Serum samples were tested for presence of antibodies against SARS-CoV-2 with the L00847 surrogate virus neutralization test (sVNT) (GenScript cPass™, USA) as described in Mariën et al ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.2 mg/mL Protein C peptide (Genscript) and 5 mM EDTA ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti c-Myc (Genscript, 0.5 μg/mL); Anti EIF3B (Santa Cruz ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.2 mg/ml protein C peptide (Genscript), and 30 µM ‘8090.
-
bioRxiv - Biochemistry 2022Quote: ... 0.2 mg/ml protein C peptide (Genscript), and 30 µM ‘8090 ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti c-Myc (Genscript, 0.3 μg/mL), Anti VCP (Santa Cruz ...
-
bioRxiv - Immunology 2022Quote: ... the ssBiotin 26nt HydMe-C Oligo (Genscript) was used ...
-
bioRxiv - Immunology 2022Quote: ... the ssBiotin 26nt HydMe-C Oligo (Genscript) was used ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 0.5 mg/mL Protein C peptide (GenScript), and 100 nM SE001 ...
-
bioRxiv - Immunology 2020Quote: ... synthesized in vitro and subcloned into a pcDNA3.4 vector containing the human IgG1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into a 293-6E expression system ...
-
bioRxiv - Immunology 2021Quote: ... synthesized in vitro and subcloned into a pcDNA3.4 vector containing the human IgG1 or IgA1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into a 293-6E expression system ...
-
bioRxiv - Immunology 2022Quote: ... nanobodies containing human IgG1 Fc in the culture supernatant were captured by AmMag Protein A Magnetic Beads (Genscript L00695) and eluted by Glycine pH 3.0 ...
-
bioRxiv - Microbiology 2022Quote: ... hACE2-Fc was produced in Expi293F cells and purified from the clarified culture supernatant using Protein G-Agarose (Genscript) followed by SEC on a Superdex 200 16/600 column linked to an AKTApure instrument (Cytiva) ...
-
bioRxiv - Molecular Biology 2022Quote: IgGFc: Human IgG Fc Sequence (Supplementary Material Figure S1) was codon optimized for HEK293 expression and synthesized from Genscript USA in pUC57 vector ...
-
bioRxiv - Immunology 2022Quote: ... and subcloned into an expression vector containing the human IgG1 or IgA1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into CHO cells ...
-
bioRxiv - Immunology 2024Quote: Cognate VH and VL antibody sequences of interest were synthesized and cloned into a customized pcDNA 3.4 vector containing a human IgG1 Fc region by GenScript Biotech ...
-
bioRxiv - Biochemistry 2021Quote: ... The cDNAs encoding mCer-mCit sensor or CRONOS were synthesized and subcloned into pET28a vector containing His6 tag (Genscript, NJ, USA).
-
bioRxiv - Biochemistry 2022Quote: The coding sequence of MtDPP was cloned into plasmid pET28a(+)in frame with an N-terminal 6×His tag (GenScript™). BL21 (DE3 ...
-
bioRxiv - Biochemistry 2022Quote: ... coding sequence was synthesised and cloned into a pET28a plasmid with N-terminal His6-tev purification tag (supplied by Genscript Ltd).
-
bioRxiv - Molecular Biology 2023Quote: ... AAP13442.1) with N-terminal His6 tags were made by inserting DNA between NcoI and BamHI sites of pET15b (GenScript, Piscataway, NJ). pET15b-His6-Nsp1(SARS CoV2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNAs coding for NSP8 and NSP7 proteins were codon-optimised and custom-synthesised with an N-terminal 6X-His tag in the pET28a vector (Figure S1, GenScript, USA). The NSP12 ...
-
bioRxiv - Biochemistry 2022Quote: Codon-optimized gene corresponding to 5 to 897 amino acids of KFDV NS5 with an N-terminal Hexa-histidine tag was synthesized (Genscript USA) and sub-cloned into pET-28a (+ ...
-
bioRxiv - Bioengineering 2021Quote: ... under two different RNP complexing conditions: 1) 10 mins at 25°C or 37°C with nuclease reaction buffer (GenScript) and 2 ...
-
Activation of endoplasmic reticulum stress via clustering of the inner nuclear membrane protein SUN2bioRxiv - Cell Biology 2022Quote: ... The construct consisting of nucleoplasmic and transmembrane domains of SUN2 and the luminal domain of SUN1 was created by amplifying SUN1 C-terminal fragment (AA 245-511) by PCR from pcDNA3.1+/C-(K)DY-SUN1 vector (OHu26731,GenScript # NM_001130965.3) using 5’-CTGTTCTAGAATGTTGGCTGGCCGTGG-3’forward and 5’-CTGTCTCGAGGCCCTGACTTGCACGTCCA-3’ reverse primers and subsequent cloning into MP029-CRY2-mCherry-SUN2-N-2 vector using the XbaI/XhoI restriction sites ...
-
bioRxiv - Immunology 2023Quote: ... The biotinylated SARS-CoV-2 fusion peptide (N’-biotin-DPSKPSKRSFIEDLLFNKVT-C’) and His-tagged HIV Env MPER peptide (N’-NWFDITNWLWYIKSGGSHHHHHHHH-C’) were chemically synthesized by GenScript.
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids for codon-optimized pET-28a- His6-nsp7-8 and pET-28a-His6-nsp7-11 (with an HRV 3C protease cleavage site between the 6x- His tag and the coding sequence) were obtained from GenScript (Piscataway, NJ). Primers used for cloning and mutagenesis ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... His-PFOR over-expression in the 6-L cultures was assessed by SDS PAGE analysis followed by immunoblotting with a His-tag specific antibody (GenScript; Fig S7). A specific band could be detected in the over-expression mutant ...
-
bioRxiv - Biochemistry 2021Quote: ... The cDNAs were then cloned into pET-15b such that the expressed proteins would contain an N-terminal His-Tag (GenScript, Piscataway, NJ). Transformation of competent DH5α E ...
-
bioRxiv - Bioengineering 2022Quote: ... The DNA construct was assembled as follows: the PSR1 gene (Cre12.g495100.t1.1) with an inserted 3xHA-tag was synthesized (Genscript Biotech Corporation, UK) and cloned into pUC57 via the StuI restriction site ...
-
bioRxiv - Molecular Biology 2023Quote: ... A custom RHINO polyclonal antibody was outsourced from GenScript using the recombinant protein described in the “Protein purification section” with 6xHIS tag retained and produced in rabbit (GenScript; 1:1000 dilution). The secondary antibodies were mouse IgG HRP-linked (NA931 ...
-
bioRxiv - Neuroscience 2023Quote: The DNA sequences of Atg9 and Lamp1 were synthesized and subcloned into pUAST-attB vector containing a EGFP or a mCherry epitope tag by Genscript (Nanjing, China). Fly microinjection was conducted by the Drosophila Core Facility ...
-
bioRxiv - Biochemistry 2023Quote: ... Equilibrated Ni-NTA resin was added to the products to bind the MBP-His tag and the His-tagged TEV protease (Genscript, Cat. # Z03030) while allowing the purified FAM210A-dMTS cleaved product to be collected in the flowthrough ...
-
bioRxiv - Synthetic Biology 2023Quote: The expression levels of his-tagged nanobodies resulting from microfermentations were quantified using the His tag ELISA detection kit (GenScript, Cat# L00436) according to the manufacturer’s protocol ...