Labshake search
Citations for GenScript :
301 - 350 of 866 citations for Chikungunya Virus E2 Envelope Protein HEK293 Mouse Fc Tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and eluted from the column by incubation with either reduced glutathione (to retain the GST tag) or with 10 units Prescission Protease (Genscript) to obtain protein without a tag ...
-
bioRxiv - Biochemistry 2024Quote: ... Equivalent aliquots (15 µL) of each fraction were analysed by SDS-PAGE and immunoblotting using anti-His tag antibody (GenScript) overnight at 4°C as per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Biophysics 2024Quote: ... or C154Y mutants optimized for expression in yeast were cloned in a pPIC9K vector upstream of a sequence coding for a PreScission protease cleavage site (LEVLFQGP) followed by a linker of 11 amino acids and a 10His tag (GenScript). The plasmids were introduced in Pichia pastoris strain SMD1163 (his4 ...
-
bioRxiv - Biophysics 2024Quote: ... A pET28a(+) plasmid containing an open reading frame for human hnRNPA1 with an N-terminal 6xHis tag was synthesized by GenScript. The 6xHis-hnRNPA1 was expressed in E ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated protein L (GenScript) and the addition of streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Microbiology 2019Quote: ... coli protein production (Genscript) and used as templates for subsequent cloning ...
-
bioRxiv - Molecular Biology 2023Quote: Serum samples were tested for presence of antibodies against SARS-CoV-2 with the L00847 surrogate virus neutralization test (sVNT) (GenScript cPass™, USA) as described in Mariën et al ...
-
bioRxiv - Immunology 2020Quote: ... synthesized in vitro and subcloned into a pcDNA3.4 vector containing the human IgG1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into a 293-6E expression system ...
-
bioRxiv - Immunology 2021Quote: ... synthesized in vitro and subcloned into a pcDNA3.4 vector containing the human IgG1 or IgA1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into a 293-6E expression system ...
-
bioRxiv - Immunology 2022Quote: ... and subcloned into an expression vector containing the human IgG1 or IgA1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into CHO cells ...
-
bioRxiv - Immunology 2022Quote: ... fused at the C-terminus to the Fc region of human IgG1 and cloned into pcDNA3.1(+) vector by Genscript.
-
bioRxiv - Immunology 2024Quote: Cognate VH and VL antibody sequences of interest were synthesized and cloned into a customized pcDNA 3.4 vector containing a human IgG1 Fc region by GenScript Biotech ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse GPx2 plasmid (GenScript) was subcloned by PCR into Xho1/BamH1 restriction sites of lentiviral expression vector pLVX-puro (Clontech) ...
-
bioRxiv - Biochemistry 2019Quote: ... NPC2 bound to LBPA isomers was detected by incubating the Snoopers with rabbit polyclonal anti-c-myc-tag antibody (RRID: AB_914457, GenScript, Piscataway, NJ) at a concentration of 0.5μg/ml in TBS + 3% BSA for one hour at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... a GlySer-linker and the C-tag flanked by PmeI sites was amplified by PCR from a synthetic fragment provided by GenScript (USA), codon-optimized for expression in a low protease background C1 ...
-
bioRxiv - Biochemistry 2021Quote: ... The cDNAs encoding mCer-mCit sensor or CRONOS were synthesized and subcloned into pET28a vector containing His6 tag (Genscript, NJ, USA).
-
bioRxiv - Biochemistry 2021Quote: Mammalian expression plasmid pcDNA3.1+/C-(K)-DYK carrying the ORF sequence of WT CYP21A2 (NM_000500.7) with a C-terminal DYK (FLAG) tag was purchased from GenScript (New Jersey, USA). We used this plasmid as a template to create the variants through site-directed mutagenesis ...
-
bioRxiv - Biochemistry 2022Quote: The coding sequence of MtDPP was cloned into plasmid pET28a(+)in frame with an N-terminal 6×His tag (GenScript™). BL21 (DE3 ...
-
bioRxiv - Biochemistry 2022Quote: ... coding sequence was synthesised and cloned into a pET28a plasmid with N-terminal His6-tev purification tag (supplied by Genscript Ltd).
-
bioRxiv - Molecular Biology 2023Quote: ... AAP13442.1) with N-terminal His6 tags were made by inserting DNA between NcoI and BamHI sites of pET15b (GenScript, Piscataway, NJ). pET15b-His6-Nsp1(SARS CoV2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNAs coding for NSP8 and NSP7 proteins were codon-optimised and custom-synthesised with an N-terminal 6X-His tag in the pET28a vector (Figure S1, GenScript, USA). The NSP12 ...
-
bioRxiv - Immunology 2023Quote: DNA encoding for residues 24-167 of the extracellular portion of human PD-1 (UniProt Q15116) with a C-terminus histidine tag or corresponding PD-1 N58Q mutant were cloned into pcDNA3.4 by GenScript (Piscataway, NJ). Expi293 cells were transiently transfected with plasmid DNA mixed with PEI (Polysciences ...
-
bioRxiv - Biochemistry 2022Quote: Codon-optimized gene corresponding to 5 to 897 amino acids of KFDV NS5 with an N-terminal Hexa-histidine tag was synthesized (Genscript USA) and sub-cloned into pET-28a (+ ...
-
bioRxiv - Plant Biology 2022Quote: Proteins were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and 4%-20% Precast Protein Plus Gel (Yeasen ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein G-Agarose beads (Genscript), Polyetheleneimine reagent (Polysciences ...
-
bioRxiv - Systems Biology 2021Quote: ... reinhardtii CDKB1 protein (Genscript, www.genescript.com)(64) ...
-
bioRxiv - Immunology 2020Quote: ... S1 and N proteins (Genscript) were conjugated onto MagPlex microsphere (Luminex ...
-
bioRxiv - Cancer Biology 2023Quote: ... biotinylated Protein L (GenScript USA) (25) ...
-
bioRxiv - Bioengineering 2023Quote: ... recombinant VZV gE protein (Genscript) diluted in coating buffer (Biolegend ...
-
bioRxiv - Cancer Biology 2024Quote: ... Bis-Tris Protein Gel (GenScript), and blotted ...
-
bioRxiv - Biochemistry 2020Quote: A human Kif15 motor domain and neck linker construct (Kif15_MD residues 1-375) in a pET21a vector with a C-terminal 6 x His-tag was generated by chemical synthesis (GenScript, Piscataway, NJ). Six of the eight cysteine residues (C5S ...
-
bioRxiv - Biophysics 2019Quote: ... pET21 vectors containing the inserted sequences for CsgF fused to the plasmid-encoded C-terminal hexahistidine tag were obtained from Genscript (Piscataway, NJ). E ...
-
bioRxiv - Biochemistry 2021Quote: ... were each synthesised with a N-terminal honeybee melittin signal peptide and a C-terminal TEV protease cleavage site and His6-tag by GenScript (Hong Kong) and subcloned into the pFastBac1 vector.
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids for codon-optimized pET-28a- His6-nsp7-8 and pET-28a-His6-nsp7-11 (with an HRV 3C protease cleavage site between the 6x- His tag and the coding sequence) were obtained from GenScript (Piscataway, NJ). Primers used for cloning and mutagenesis ...
-
bioRxiv - Biochemistry 2021Quote: ... plasmid containing the full-length Arabidopsis thaliana Atm3 (AtAtm3) gene with a C-terminal 6x-His tag was purchased from Genscript (Genscript, NJ). Mutagenesis reactions generating the N-terminal 60 ...
-
bioRxiv - Biochemistry 2020Quote: ... fused to the Saccharomyces cerevisiae alpha factor secretion signal (N-terminal)40 followed by a C-terminal Sortase-A recognition sequence and a His6 tag (C-terminal) was synthesized and cloned into pPICZalpha by GenScript (NJ, USA) using EcoRI and SacII restriction sites to produce pPICZalphaA-RBD-Hisx6.
-
bioRxiv - Biochemistry 2020Quote: ... and followed by a C-terminal Sortase-A recognition sequence for covalent coupling39 and a His6 tag for purification (LPETGHHHHHH) was synthesized by GenScript (NJ, USA) and cloned into the pCDNA3.1(+ ...
-
bioRxiv - Cell Biology 2022Quote: ... Coding sequence of SARS-CoV-2 S gene (GenBank: QHU36824.1) fusion with a c-terminal His tag was synthesized in vitro (Genscript, Piscataway, NJ, USA) after an optimization for expression in human cells.16 The sequence was cloned into a pcDNA3.1 vector to obtain pcDNA-Spike.16
-
bioRxiv - Pathology 2020Quote: ... Coding sequence of SARS-CoV-2 S gene (GenBank: QHU36824.1) fusion with a c-terminal His tag was synthesized in vitro (Genscript, Piscataway, NJ, USA) after codon optimization for expression in human cells ...
-
bioRxiv - Biophysics 2021Quote: ... coli optimized codons for the C0-C2 portion of human cMyBP-C with N-terminal 6x His tag and TEV protease cleavage site were obtained from GenScript (Piscataway, NJ). For TR-FRET binding assays ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... His-PFOR over-expression in the 6-L cultures was assessed by SDS PAGE analysis followed by immunoblotting with a His-tag specific antibody (GenScript; Fig S7). A specific band could be detected in the over-expression mutant ...
-
bioRxiv - Microbiology 2020Quote: A synthetic gene encoding an human ACE2 fragment (residues 1-615) fused with a C-terminal 6xHis tag was generated by GenScript (Piscataway, NJ) and cloned into pCMV-IRES-puro expression vector (Codex BioSolutions ...
-
bioRxiv - Bioengineering 2022Quote: ... The DNA construct was assembled as follows: the PSR1 gene (Cre12.g495100.t1.1) with an inserted 3xHA-tag was synthesized (Genscript Biotech Corporation, UK) and cloned into pUC57 via the StuI restriction site ...
-
bioRxiv - Microbiology 2022Quote: ... codon optimized genes encoding each PcaLOOL were obtained as subcloned in pPICZαA plasmids with a C-terminal 6 x His tag (GenScript, Piscataway, NJ, USA). P ...
-
bioRxiv - Neuroscience 2023Quote: The DNA sequences of Atg9 and Lamp1 were synthesized and subcloned into pUAST-attB vector containing a EGFP or a mCherry epitope tag by Genscript (Nanjing, China). Fly microinjection was conducted by the Drosophila Core Facility ...
-
bioRxiv - Biochemistry 2023Quote: ... Equilibrated Ni-NTA resin was added to the products to bind the MBP-His tag and the His-tagged TEV protease (Genscript, Cat. # Z03030) while allowing the purified FAM210A-dMTS cleaved product to be collected in the flowthrough ...
-
bioRxiv - Synthetic Biology 2023Quote: The expression levels of his-tagged nanobodies resulting from microfermentations were quantified using the His tag ELISA detection kit (GenScript, Cat# L00436) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: Protein samples were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) or 10% SDS-PAGE gels and electrophoresed at 150 V for 2 h ...