Labshake search
Citations for GenScript :
301 - 350 of 686 citations for CKLF Like MARVEL Transmembrane Domain Containing 7 CMTM7 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... a biotinylated rat polyclonal antibody against human Fc was used as a capture antibody and anti-human IgG Fc-HRP (GenScript Cat# A01854-200) as a detection antibody ...
-
bioRxiv - Cell Biology 2023Quote: ... The membrane sections were then incubated overnight at 4°C with the corresponding antibody: anti-ChmA (dilution = 1:500; custom GenScript polyclonal rabbit antibody), HRP-conjugated mouse anti-RpoB (dilution = 1:5,000 ...
-
bioRxiv - Molecular Biology 2019Quote: Purified ERα LBD containing amino acids 315-545 used by Brzozowski et al for crystallization16 with a his-tag was custom made (GenScript). All reactions were set up in 20 μL reactions in 96 well plates with purified ERα LBD at a concentration of 0.6 μg/μL and 10x SPYRO orange dye (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: The full-length human NatD gene was amplified and cloned into a modified pET-21a(+) vector containing an 8x-His-tag and SUMO protease cleavage site at the N-terminus (Genscript). This pET-21a(+)-hNatD construct was transformed into Escherichia coli BL21 (DE3 ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 St containing 2X-StrepTag at the C-terminal region was commercially synthesized as mentioned above (GenScript Biotech). SARS-CoV-2 N ...
-
bioRxiv - Biophysics 2021Quote: pET-DUET expression plasmids containing the genes for barnase and barstar under the control of their own T7 promoter were obtained from GenScript Biotech Corporation (Piscataway ...
-
bioRxiv - Cell Biology 2020Quote: ... S100 supernatant was added directly to 600 μL of basic lysis buffer with protease inhibitors and NEM containing 30 μL 1:1 anti FLAG Affinity Gel (Genscript). All samples were incubated overnight at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... knock-out was constructed by cloning a chloramphenicol marker to the pUC57 plasmid containing the sequences flanking acr1 (here named as pJL8, purchased from Genscript). The plasmid pJL10 was constructed by cloning the PT5-acr1-kanr cassette (Luo et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... we obtained an expression plasmid containing a C-terminal 3Xflag tagged BioID2 sequence with a 198bp (13X “GGGGS” repeat) linker sequence upstream of BioID2 (Genscript). For lentiviral expression ...
-
bioRxiv - Neuroscience 2022Quote: Gja1 overexpression in ANS4-GFP was performed using a pcDNA3.1+ /C-(K)DYK vector containing mus musculus Gja1 (Cx43) cDNA (GenScript NM_010288.3). Transfection was performed according to the manufacturer’s experimental protocol in 6-well plate ...
-
bioRxiv - Bioengineering 2022Quote: ... The cassette containing the two-sgRNA array (targeting msfGFP and mScarlet) and the codon-optimized cas6 were purchased from Genscript and further cloned to the sgRNA expressing backbone ...
-
bioRxiv - Cell Biology 2022Quote: ... RGD-containing peptides derived from SARS-CoV-2 (ADSFVIRGDEVRQIAPGQTG) and KGD-containing peptides derived from SARS-CoV (ADSFVVKGDDVRQIAPGQTG) were produced by Genscript. Integrin-blocking (GRGDSP ...
-
bioRxiv - Microbiology 2022Quote: ... plasmid pUC57-KRV-9000-11375 containing part of NS5 gene and the 3’ UTR of KRV (nt 9000-11375) was synthesized by GenScript.
-
bioRxiv - Biochemistry 2021Quote: 10 mg of lyophilized peptide containing a Sortase recognition sequence(56) (57) and a single cystine residue for maleimide labeling (CLPETGG, GenScript) was dissolved in reaction buffer (50 mM Tris 7.0 and 5 mM TCEP ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Immunology 2021Quote: TCR constructs containing full-length TCRα and TCRβ or TCRγ and TCRδ chains separated by a 2A-cleavable linker were produced (Genscript) and cloned into the pMIG II plasmid ...
-
bioRxiv - Molecular Biology 2021Quote: ... Variants of CMV-ubi-nsP4-RRV and CMV-ubi-nsP4-SINV containing mutations listed in supplementary figure S6 were constructed using synthetic DNA fragments (Genscript). Sequences of all plasmids were verified using Sanger sequencing and are available from the authors upon request.
-
bioRxiv - Neuroscience 2022Quote: ... we obtained an expression construct containing a 198bp (13x “GGGGS” repeat) linker sequence upstream of a C-terminal 3xFLAG-tagged BioID2 sequence with BioID2 (Genscript). For lentiviral expression ...
-
bioRxiv - Immunology 2023Quote: ... were actively induced with EAE on day 0 by subcutaneous injection of a 100 μL total volume containing 200 μg MOG35-55 peptide (GenScript), 100 μg recombinant human MOG (rhMOG1-120 prepared in-house ...
-
bioRxiv - Cancer Biology 2023Quote: ... or vector containing full-length METTL7A or METTL7B with a C-terminus FLAG tag (all vectors from Genscript, Piscataway, NJ) using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: The vectors pUC57-[EMCV nt.373-1656] for transcription of wt and mutant EMCV IRES-containing mRNA were made by GenScript and contained a T7 promoter followed by EMCV nt.373-1656 ...
-
bioRxiv - Microbiology 2023Quote: ... The homology region was directly linked to a synthesized functional codon-changed version of the corresponding candidate containing all selected mutations (Genscript). The fragments of the homology region and the mutated recodonized sequence of all candidates were cloned by Gibson assembly into the pSLI-TGD vector via NotI/MluI ...
-
bioRxiv - Immunology 2022Quote: Peptides: Synthetic peptides containing the FP and HR2 coldspot sequences were designed and obtained (> 75% purity) from GenScript (Hong Kong). Peptides were biotinylated (biotin-Ahx ...
-
bioRxiv - Synthetic Biology 2023Quote: ... This was then back diluted 1:10 into DMEM-FBS media used for growing LLC-sppIP cells or fresh media containing synthetic sppIP peptide (Genscript). Media from LLC-sppIP cells was collected after 24 h of growth in 96 well plates.
-
bioRxiv - Biochemistry 2023Quote: Wildtype and mutant PRD-0038 S constructs consisting of residues 1-1235 and containing a 21 residue C-terminal deletion (del21) followed by a 3x FLAG tag were synthesized by GenScript and placed into an HDM plasmid ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were transiently transfected with plasmids containing receptors of interest under eukaryotic expression promoters (ASGR1 was clone OHU03658D from GenScript), then split into 96-well plates (20,000 cells per well ...
-
bioRxiv - Microbiology 2024Quote: ... lentiviruses were generated in HEK293T cells by transfection of pLentiCRISPRv2 -Puro plasmid containing a single guide RNA (sgRNA) (GTACTGTAGATGGTGCTCAT) (GenScript) targeting ACE2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Transfer was done at 20 V for 1 hour buffer containing 25 mM Tris base and 25 mM Bicine (M00139, GenScript) supplemented with 10% absolute ethanol (20821.330 ...
-
bioRxiv - Immunology 2024Quote: ... 293F cells were transfected with plasmids containing Spike protein (ATUM plasmid pD2528-CMV with insert QHD43416.1) and Spike-2P protein (site-directed mutagenesis to generate the 2P mutation on the plasmid containing Spike protein, GenScript) by 293fectinTM transfection reagent (Gibco ...
-
bioRxiv - Biophysics 2024Quote: ... A pET28a(+) plasmid containing an open reading frame for human hnRNPA1 with an N-terminal 6xHis tag was synthesized by GenScript. The 6xHis-hnRNPA1 was expressed in E ...
-
bioRxiv - Biochemistry 2023Quote: ... the expression levels of each mutant series and their wild-type version were normalized for comparison purposes by quantitation via western blots against the 6xHis tags present at the C-termini of all constructs (Antibody: anti-His-Tag Antibody coupled with iFlour 488, Genscript, A01800, 1:500 dilution). Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Developmental Biology 2020Quote: ... custom made rabbit anti-chick MMP13 antibody (1μg/ml, Genscript), rabbit anti-CXCL14 (0.2 μg/ml ...
-
bioRxiv - Immunology 2022Quote: ... Horseradish peroxidase labeled mouse anti-His tag antibody (GenScript: A00186) was added for 30 minutes at 1:1000 dilution ...
-
bioRxiv - Biochemistry 2022Quote: ... 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984), 1:1000 anti-HA-Tag (C29F4 ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-mouse ZIP14 antibody was custom made by Genscript. Antibodies for GAPDH and actin were obtained from Cell Signalling.
-
bioRxiv - Microbiology 2021Quote: ... Polyclonal antibodies against OVA or SV40 were obtained from GenScript (GenScript ...
-
bioRxiv - Microbiology 2022Quote: ... in-house custom rabbit anti-RVFV nucleoprotein polyclonal antibody (Genscript) and anti-pan cytokeratin typeI/II anti-cytokeratin polyclonal antibody (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... labeling with 1:200 biotinylated anti-Strep tag antibody (GenScript) was followed by 1:500 BrilliantViolet 421 conjugated with Streptavidin (Biolegend) ...
-
bioRxiv - Microbiology 2022Quote: ... Mouse Anti-Rabbit IgG Fr secondary antibody (GenScript, Piscataway, NJ) 1:30,000 was used for assays of these rabbit-derived samples ...
-
bioRxiv - Microbiology 2021Quote: ... for SyNOS and a specific OtNOS antibody generated by GenScript Company.
-
bioRxiv - Plant Biology 2019Quote: ... and incubated with anti-c-Myc primary antibody solution (GenScript, 1 ...
-
bioRxiv - Microbiology 2019Quote: Peptide antibodies to the six TIPs were generated by GenScript using their standardized work flow ...
-
bioRxiv - Neuroscience 2021Quote: We used the following primary antibodies: NEEP21/NSG1 (Genscript A01442), FAM21 (Millipore ABT79) ...
-
Metal transporter SLC39A14/ZIP14 modulates regulation between the gut microbiome and host metabolismbioRxiv - Physiology 2021Quote: ... Rabbit anti-mouse ZIP14 antibody was custom made by Genscript. Antibodies for ZIP4 ...
-
bioRxiv - Microbiology 2020Quote: ... Rabbit anti-PknG antibody was produced and purified by GenScript Biotechnology with the recombinant GST-tagged PknG protein as immunogen (1/10000 for immunoblotting ...
-
bioRxiv - Microbiology 2020Quote: ... A human chimeric anti-S1 antibody (Genscript; 1:200 dilution) followed by an Alexa647-conjugated goat anti-human IgG (Jackson Laboratories ...
-
bioRxiv - Microbiology 2020Quote: A custom polyclonal anti-KH antibody was generated by GenScript, using their 49-day antibody generation protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and polyclonal αcGAS antibodies were purified by antigen affinity (GenScript). Serum was used at 1:30,000 for cGAS detection ...
-
bioRxiv - Molecular Biology 2023Quote: The polyclonal primary antibody anti-Orco was purchased from Genscript and designed against the peptide sequence SSIPVEIPRLPIKSFYPW in the second extracellular loop (ECL2) ...
-
bioRxiv - Biophysics 2023Quote: ... The His-Tag antibody (Cat# A00186S, GenScript, New Jersey, US) for 2h at RT ...