Labshake search
Citations for GenScript :
301 - 350 of 909 citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... labeling with 1:200 biotinylated anti-Strep tag antibody (GenScript) was followed by 1:500 BrilliantViolet 421 conjugated with Streptavidin (Biolegend) ...
-
bioRxiv - Molecular Biology 2019Quote: ... -voltage-dependent anion-selective channel 1 (VDAC1, Genscript, cat # A01419), -succinate dehydrogenase complex ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cDNA for hHIPK2 isoform 1 was synthesized by GenScript® to match the NCBI reference sequence NM_022740.4 ...
-
bioRxiv - Microbiology 2020Quote: ... A human chimeric anti-S1 antibody (Genscript; 1:200 dilution) followed by an Alexa647-conjugated goat anti-human IgG (Jackson Laboratories ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μg of the industrial grade GFPxm163-pcDNA3.1(+) plasmid (GenScript), 1.5 μL of Lipofectamine 3000 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Larger mutations (Indels >1 amino acid) were performed by GenScript directly using the previously synthesized construct as a template ...
-
bioRxiv - Immunology 2023Quote: ... and PGT151 and 1-18 IgGs were produced by Genscript based on publicly available sequences.
-
bioRxiv - Biochemistry 2023Quote: ... Depsi Aβ (1–42) peptide (click peptide) (Genscript, ref. RP10017) was dissolved in 0.1% TFA to a final concentration of 200 μM (stock solution ...
-
bioRxiv - Plant Biology 2023Quote: ... and Goat- Anti-Mouse IgG [HRP] (1:3000; GenScript, A00160) secondary antibody ...
-
bioRxiv - Biochemistry 2023Quote: ... Human Pcdh21 isoform 1 (NCBI accession NP_149091.1) was synthesized (GenScript) and cloned into a pCDNA3.1 vector (ThermoFisher ...
-
bioRxiv - Systems Biology 2024Quote: ... Calmodulin binding peptide 1 (MLCK peptide) was purchased from Genscript Biotech Corp ...
-
bioRxiv - Immunology 2023Quote: ... THETM V5 Tag antibody (both at 1:5000 dilution, GenScript), and CLIPA8 primary antibody (1:5000 dilution ...
-
bioRxiv - Biochemistry 2021Quote: ... which contained an intact 3’UTR (GenScript, Piscataway, NJ). Two concentrations of Zfp36l1 (WT and mutant ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was collected pre-cleared with 20 µl Protein A/G MagBeads (GenScript) per 1.5 ml lysate for 30 minutes ...
-
bioRxiv - Biochemistry 2023Quote: Codon optimized LayV F and G open reading frames were synthesized by Genscript and subcloned into a mammalian promoter modified expression vector pcDNA3.1-CMV77 ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmids containing the L245A and L245C substitutions in gene 8 were also made by GenScript. The constructs ...
-
bioRxiv - Neuroscience 2023Quote: ... # E7) in 5% non-fat milk TBST and FOLR1 antibody in 5% non-fat milk TBST (GenScript). Anti-GFP antibody or normal rabbit IgG were used as controls in FOLR1-CD2AP co-IP experiments.
-
bioRxiv - Cell Biology 2021Quote: ... which was synthesized to contain 7 modified TetO elements flanked by two minimal CMV promoter sequences based on pTet-T2 sequences (GenScript) (49) ...
-
bioRxiv - Biochemistry 2020Quote: ... coli codon-optimized version of VC1 coding for an N-terminal His-tag and lacking the predicted cTP-coding region (Supplementary File 7) was synthesized (GenScript) and cloned into expression vector pET22b(+ ...
-
bioRxiv - Microbiology 2022Quote: ... The plasmids were generated by synthesis of Flex-mCherry and Flex-eGFP and inserted into humanized M plasmids described in [7] using EZcloning from Genscript. The SARS-CoV-2 N protein was tagged at the N-terminus ...
-
bioRxiv - Developmental Biology 2020Quote: ... ID U3154EL200-3)27 or Tbx4-LME containing putative Tcf/Lef sites mutated (GenScript, ID U3154EL200-6) were synthesized and cloned into pGL4.23 (luc2/minP ...
-
bioRxiv - Molecular Biology 2023Quote: The 6-FAM-labeled and non-labeled RNA oligonucleotides were synthesized chemically by GenScript. The RNA annealing reaction containing 10 mM Tris-HCl (pH 7.4 at 25°C) ...
-
bioRxiv - Genetics 2023Quote: ... Identified homozygous PC-9_ EGFRdel19-ARTi clones were further engineered by cutting endogenous EGFR with a CRISPR all-in-one vector pX458_Exon20_gRNA TAGTCCAGGAGGCAGCCGAA (GenScript) using X-tremeGENE 9 DNA transfection reagent (Roche ...
-
bioRxiv - Immunology 2021Quote: ... at a final concentration of 1 μg/mL per peptide (GenScript). Splenocytes were plated in duplicate at 1×105 cells per well and 2.5×104 cells per well (mixed with 7.5×104 naïve cells ...
-
bioRxiv - Microbiology 2020Quote: Human EnvP(b)1 codon-optimized sequence was ordered from GenScript. EnvP(b)1 sequences from chimpanzee ...
-
bioRxiv - Plant Biology 2021Quote: ... followed by Goat Anti-Mouse IgG [HRP] (1:3000; GenScript A00160) as the secondary ...
-
bioRxiv - Immunology 2022Quote: ... NL63 (YP_003767.1) and WIV-1 (Uniprot – U5WI05) were synthesized from Genscript. HIV-based HcoV spike glycoprotein-pseudotyped viruses were prepared as previously described (70 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: The gene encoding human CDK2 (1-298) was custom-synthesized (GenScript), subcloned into pGEX6P1 vector providing an N-terminal GST-tag and expressed in E ...
-
bioRxiv - Biophysics 2020Quote: ... The Mfd full-length (1–1148) construct was purchased from Genscript in a pET28b(+ ...
-
bioRxiv - Biochemistry 2020Quote: ... 1+/c-(k) - dyk expression vector for mammalian cells by GenScript Corporation (Piscataway ...
-
bioRxiv - Microbiology 2019Quote: ... Supernatants were incubated with 500 pM GLP-1 (Tocris or GenScript) for 4 h at room temperature ...
-
bioRxiv - Genomics 2021Quote: ... The following antibodies were used: Gcn5 (rabbit polyclonal, 1:1000, (GenScript antibody services ...
-
bioRxiv - Molecular Biology 2021Quote: ... pS23-Ab 1:10,000 (Custom generated by GenScript; peptide sequence-CKILTHYENDSPTDLR). The cells were washed and incubated with secondary antibodies Alexa fluor 488 goat anti-mouse (Thermo fisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... a fragment corresponding to CIP2A (1-560) was cloned by Genscript into pGADT7 AD (Clontech/Takara ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μg of the industrial grade CytERM-GFPxm163-pcDNA3.1(+) plasmid (Genscript), 1.5 μL of Lipofectamine 3000 ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Molecular Biology 2023Quote: ... Primary antibodies used were anti-strep tag (GenScript, A01732, 1/1000), anti-PHF21A (in house ...
-
bioRxiv - Genomics 2024Quote: ... and shRNA oligos for insertion (Table 1) were synthesized by GenScript. Oligos were reconstituted in water at a concentration of 100 μM ...
-
bioRxiv - Biochemistry 2023Quote: ... His-ERK was further purified using 1 mL glutathione resin (GenScript) to remove any residual GST-tagged MKK1.
-
bioRxiv - Microbiology 2023Quote: ... affinity-purified rabbit polyclonal (peptide SSTEPASTGTPSSGC, produced by GenScript, 1:1000), followed by donkey anti-rabbit Alexafluor555 (Invitrogen A31572 ...
-
bioRxiv - Microbiology 2020Quote: ... Fragment 4 was ordered as synthetic sequence (GenScript) with the first 274 bp recodonised and was amplified from plasmid pUC57-re-ap2-hc-1 using primers ap2-hc-5'_HR2_re_F and ap2-hc-5'_HR2_re_R.
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were resolved on 4%-12% (GenScript, M00654) or 4%-20% (GenScript ...
-
bioRxiv - Developmental Biology 2023Quote: ... then 4 × LDS sample buffer (GenScript, M00676-10) was added ...
-
bioRxiv - Developmental Biology 2021Quote: ... Proteins were run on gradient pre-cast SDS polyacrylamide gels (8-16%, ExpressPlu, GenScript, M81610, Piscataway, USA) before being transferred to nitrocellulose membranes (0.45μm ...
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Supplementary Table 3) and synthesized in vitro (Genscript). For protein expression ...
-
bioRxiv - Plant Biology 2022Quote: ... and AtNLP1-3 were codon-optimized and synthesized by Genscript, NJ ...
-
bioRxiv - Molecular Biology 2023Quote: ... All utrophin 3’UTR reporter constructs were generated by GenScript Biotech (Leiden ...
-
bioRxiv - Molecular Biology 2023Quote: The published DARPin TM-3 sequence22 was synthesized by GenScript and cloned into a pST50 expression vector27 with N-terminal 6x His tag using Gibson assembly ...
-
bioRxiv - Biophysics 2020Quote: Mouse 5-HT3AR gene (purchased from GenScript) and mutant genes were inserted into pTLN plasmid ...
-
bioRxiv - Immunology 2019Quote: ... The PIFS model employed by our group involves the tail vein injection of 100μL of a 1mg/mL solution of VP2121-130 peptide (FHAGSLLVFM) in PBS at either 7 or 14 days after the original TMEV infection (GenScript, Nanjing) [38-43] ...