Labshake search
Citations for GenScript :
251 - 300 of 561 citations for pLenti CMV TO Puro DEST 670 1 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... strains were arrested in G1 with 100 ng ml-1 alpha factor (GenScript) and incubation was continued for 3 hours ...
-
bioRxiv - Physiology 2021Quote: ... PC-1 and PC-2 coiled-coil domain peptides were custom-made (Genscript). PC-1 or PC-2 peptides were added to pipette solution immediately before use at a final concentration of 1 μM ...
-
bioRxiv - Microbiology 2022Quote: The SARS-CoV-2 Wuhan-Hu-1 RBD construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Cell Biology 2024Quote: Protein lysates were incubated with 1 µg mouse anti-V5 antibody (Genscript A01724) for 2 h at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the muscle-specific MCK promoter (gift from Jeff Chamberlain) ...
-
bioRxiv - Immunology 2022Quote: His tag-IP was performed using anti-His affinity resin (GenScript L00439-1) and Myc tag-IP was performed using anti-Myc affinity resin ...
-
bioRxiv - Immunology 2023Quote: ... and 1 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Genomics 2023Quote: CUT&Tag was performed with mouse anti-HA antibodies (1:100, Genscript #A01244), rabbit anti-H3K4me3 antibodies (1:100 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 dish per sample) were transfected with FLAG-GFP and FLAG-SF3B2 (GenScript) (14 µg DNA per dish ...
-
bioRxiv - Neuroscience 2024Quote: ... for fly protein samples or 2G7D4 (GenScript, Piscataway, NJ, USA; Mouse; 1:2,000) for mouse protein samples ...
-
bioRxiv - Immunology 2024Quote: ... Cells were pulsed with 1 µg/mL SIINFEKL peptide (Genscript, Piscataway, NJ, USA) for 1 h at 37 °C prior to use as targets for mouse OTI CTLs.
-
bioRxiv - Cancer Biology 2024Quote: ... immature BMDCs were harvested and loaded with 1 μg/ml OVA257-264 (GenScript), B16-OVA-Ogt+/+ and B16-OVA-Ogt−/− cells supernatant at 37°C for 6 h ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of competence specific peptide (1 mg/mL, DLRGVPNPWGWIFGR, synthetized by GenScript) and 1-5 µL of linear double-stranded DNA PCR product were mixed in a microcentrifuge tube ...
-
CRISPR-based environmental biosurveillance assisted via artificial intelligence design of guide-RNAsbioRxiv - Molecular Biology 2024Quote: ... 1 µL of 10 µM reporter (poly-U5 or poly-U15, GenScript, custom), 0.96 µL of 10 µM forward primer (GenScript ...
-
bioRxiv - Microbiology 2024Quote: ... (30) using anti-OROV nucleoprotein IgG (1:100 dilution; custom made by Genscript). Primary delete and no infection controls were performed to identify non-specific binding of the secondary detection antibody or all reagents ...
-
bioRxiv - Developmental Biology 2020Quote: ... A primary antibody specifically for zebrafish was used to detect Esco2 (1:1000, GenScript). Alexa 546 anti-rabbit (1:1000 ...
-
bioRxiv - Bioengineering 2021Quote: ... Hydrogel precursor solution was prepared by incorporating thiolated RGD peptide (GCGYGRGDSPG, 1 mM, Genscript) to promote integrin-mediated cell adhesion and lithium acylphosphinate (LAP ...
-
O-GlcNAcylation reduces phase separation and aggregation of the EWS N-terminal low complexity regionbioRxiv - Biochemistry 2021Quote: ... residues 1-264 (N-terminal LCR; LCRN) was synthesized by GenScript (Piscataway, NJ, USA) with codon optimization for expression in Escherichia coli ...
-
bioRxiv - Neuroscience 2022Quote: ... we inserted the designed sgRNA to target exon-1 of Ezrin (TGGCTGGTTGGTGGCTCTGCGTGGGT) (Genscript: NM_001271663.1_T3). Finally ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Bipartite proteins were detected using the rabbit anti-mCherry (A00682, GenScript, 1:3000 diluted), the mouse anti-His (A00186 ...
-
bioRxiv - Immunology 2020Quote: HLA-A*0201-restricted MART-1 peptide ELAGIGILTV) was synthesized by GenScript (Nanjing, China). Peptide was stored at 10 mg/ml in 100% dimethyl sulfoxide (DMSO ...
-
bioRxiv - Immunology 2020Quote: MART-1 originated peptide ELAGIGILTV (HLA-A*0201) was synthesized by GenScript (Nanjing, China) with a purity of ≥ 99.0% ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Cancer Biology 2022Quote: FITC-CCNL1321-332 peptides (numbering according to Uniprot Q9UK58-1) were purchased from GenScript and FITC-cyclin E377-384 peptides (numbering according to Uniprot P24864-3 ...
-
bioRxiv - Microbiology 2022Quote: ... The following primary antibodies were used at 1:5000 dilution: anti-FLAG antibody (GenScript), and anti-GAPDH antibody (Proteintech) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequences were split into 1–1.5 kilobase fragments and ordered as GenParts from GenScript. Primers were ordered from QuintaraBio to amplify from the ends of each GenPart ...
-
bioRxiv - Cancer Biology 2024Quote: ... and diluted 1:5000 HRP-conjugated goat anti-rabbit IgG (cat no. A00098, GenScript) were used as secondary antibodies ...
-
bioRxiv - Molecular Biology 2022Quote: ... VHL 3KR-14-3-3ζ (1-230) 19KR K49E mutation were synthesized by GenScript Biotech ...
-
bioRxiv - Microbiology 2022Quote: ... The following antibodies were used: rabbit anti-GST (GenScript, A00097, 1:2000 for WB), rabbit anti-Flag (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Bioengineering 2023Quote: ... Cell adhesion was enabled through the incorporation of 1 mM RGD peptide (GCGTGRGDSPG, Genscript) in all hydrogel groups.
-
bioRxiv - Immunology 2024Quote: ... plates were incubated for 1 h with monoclonal anti-nucleocapsid virus mouse antibody (Genscript) diluted 1:1000 in blocking buffer (PBS 1X containing 1% BSA (Sigma Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... Cells were then stimulated with 1 μM of test peptides (custom peptide synthesis, GenScript) or control reagents as indicated in each relevant figure legend and costimulatory antibodies anti-CD28 (BD Biosciences ...
-
bioRxiv - Plant Biology 2024Quote: WT or mutated lysine 4 trimethylated H3 (1-20aa) peptides were synthesized by GenScript Biotech Corporation ...
-
bioRxiv - Pathology 2024Quote: The following primary antibodies were used for western blot: TSP2 Antibody (1:250, GenScript), β-Catenin Antibody (1:500 ...
-
bioRxiv - Immunology 2024Quote: ... Serum samples were diluted (1:10) and preincubated with 100 ng/ml RBDmFc (Genscript) in blocking buffer for 1 hour at room temperature ...
-
bioRxiv - Biochemistry 2024Quote: ... and eluted by W1 buffer supplemented with 250 μg ml-1 Flag peptide (Genscript). The eluent was concentrated and further purified by size-exclusion chromatography (Superose-6 Increase 10/300 column ...
-
bioRxiv - Biochemistry 2024Quote: ... anti-MBP tag Mouse Monoclonal antibody was used at 1:1000 dilution (GenScript, A00190), GST tag Mouse Monoclonal antibody was used at 1:1000 dilution (STARTER ...
-
bioRxiv - Molecular Biology 2020Quote: HCoV-19 S gene (virus isolate: Wuhan Hu-1; GenBank number QHD43416.1) was synthesized (Genscript) with codons optimized for insect cell expression ...
-
bioRxiv - Bioengineering 2021Quote: The 14 designs chosen for experimental tests from PIP version 1 were ordered from GenScript pre-cloned into the pET-21a expression vector ...
-
bioRxiv - Microbiology 2021Quote: ... the membrane was incubated with 1:7000 polyclonal anti-Bma-LAD-2 peptide antibodies (Genscript) and 1:1000 rabbit anti-β actin antibodies (Abcam ...
-
bioRxiv - Microbiology 2020Quote: ... The expression of each anti-HIV-1 CAR was detected by protein L-biotin (GenScript) and Alexa488-conjugated anti-human Fc antibody or APC-conjugated anti-human Fc antibody as described elsewhere [78] ...
-
bioRxiv - Biochemistry 2022Quote: cDNA constructs for expression of recombinant Mac-1 in mammalian cells were generated by GenScript. ITGAM cDNA was cloned into the vector pcDNA3.1/HygroB(+) ...
-
β-amyloid−driven synaptic depression requires PDZ protein interaction at AMPA-receptor subunit GluA3bioRxiv - Neuroscience 2021Quote: ... The following antibodies were used: anti-GluA2/3 (1:2000; CQNFATYKEGYNVYGIESVKI, custom made at Genscript) (Chen et al. ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (GenScript, USA) in carbonate bicarbonate buffer (pH 9.6 ...
-
bioRxiv - Microbiology 2021Quote: Microtiter plates (96-well; Thermo) were coated with 1 μg/mL S-2P protein (Genscript) corresponding to the S protein of the Wuhan-Hu-1 virus ...
-
bioRxiv - Biochemistry 2021Quote: ... the codon-optimized WP_011499504.1 ORF was subcloned into pGEX-4T-1-H expression vector (Genscript) to create pGEX4T1_ WP011499504 ...
-
bioRxiv - Biophysics 2020Quote: The gene corresponding to residues 1-201 of colicin 5 (colE5-T) was synthesized (GenScript) and cloned into pET21(+ ...
-
bioRxiv - Molecular Biology 2020Quote: ... The following antibodies were used in this study: anti-myc (1:1000 Genscript A00173-100), anti-Rad53 (1:1000 Abcam ab104232) ...