Labshake search
Citations for GenScript :
251 - 300 of 526 citations for Zika Virus NS1 Proteins Uganda Suriname Strains Duo Pack since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: LD membrane protein cDNAs in pcDNA3.1+/C-(k)DYK were purchased from GenScript and their variants with the OPG2 tag ...
-
bioRxiv - Immunology 2022Quote: ... and the supernatants were further purified with protein A magnetic beads (Genscript, L00695).
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was collected pre-cleared with 20 µl Protein A/G MagBeads (GenScript) per 1.5 ml lysate for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: Protein samples were separated in a pre-cast SDS-PAGE gel (GenScript, M00657) and blotted to a PVDF membrane (EMD Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids expressing human KLF family proteins were purchased from Genscript (Piscataway, NJ) or OriGene (Rockville ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins with a His tag was purified with the Ni-NTA resin (Genscript) according to the product manual ...
-
bioRxiv - Molecular Biology 2023Quote: ... The bound proteins were eluted with Flag peptide (200 μg/ml; GenScript, RP10586) in thermomixer at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... This clarified protein lysate was then shaken with Ni-charged IMAC Magbeads (Genscript) for 1 hour to bind tagged proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant BRD4 N-terminal protein was purchased from GenScript (BRD4-N (49-460aa), His ...
-
bioRxiv - Cell Biology 2024Quote: Protein lysates were incubated with 1 µg mouse anti-V5 antibody (Genscript A01724) for 2 h at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... 8 µg of protein was loaded onto a 10% SurePAGE polyacrylamide gel (Genscript) and resolved for 1 cm ...
-
bioRxiv - Molecular Biology 2020Quote: ... The protein complexes were detected by western blot with anti-His antibody (Genscript, A00186) and anti-Flag antibody (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: The proteins were codon optimized for eukaryotic expression and de novo synthesized by GenScript.
-
bioRxiv - Plant Biology 2019Quote: ... 1:500 (produced for this study using full length protein as antigen by GenScript); α-Actin ...
-
bioRxiv - Biochemistry 2020Quote: ... 293T cells were transiently transfected with plasmids expressing SARS-CoV-2 spike protein (GenScript MC_0101081 ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV-2 Spike protein (S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ) was added at concentrations ranging from 0.07 to 500 to nM ...
-
bioRxiv - Immunology 2020Quote: Plasmids encoding cDNAs for hMPV F proteins listed in Table S1 were synthesized (GenScript) and cloned into the pcDNA3.1+ vector ...
-
bioRxiv - Cell Biology 2021Quote: ... 25 μg protein from each sample was mixed with LDS Sample Buffer (M00676, GenScript) and loaded in each well of a 4-20% SurePAGE™ Bis-Tris gel (M00656 ...
-
bioRxiv - Bioengineering 2022Quote: We obtained the genes encoding the designed proteins in pET28a vectors from GenScript (Genscript.com). We confirmed the sequences of all the constructs by DNA sequencing (Eton bioscience ...
-
bioRxiv - Plant Biology 2019Quote: ... SlMai1-myc or synSlMai1-myc proteins were detected using anti-Myc antibodies (GenScript; A00704) and chemilumiscent ECL Plus substrate (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Bipartite proteins were detected using the rabbit anti-mCherry (A00682, GenScript, 1:3000 diluted), the mouse anti-His (A00186 ...
-
bioRxiv - Microbiology 2021Quote: ... All the proteins were endotoxin free (ToxinEraserTM Endotoxin Removal Kit, GenScript Biotechnology, Nanjing, China).
-
bioRxiv - Microbiology 2022Quote: ... 10^5 splenocytes were seeded and stimulated with peptides against S protein (From GenScript) (2μg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... gene segment containing spike protein of SARS-CoV-2 wa s synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2020Quote: Mouse mAb 10G6H5 against SARS-COV2 S protein was purchased from GenScript (Piscataway, NJ). Rabbit antisera against the S1 subunit ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... GiGrx5 and GiBolA proteins were detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal GiTom40 and GiIscU were detected with a specific polyclonal antibody raised in rabbits (84) ...
-
bioRxiv - Microbiology 2022Quote: ... fumigatus-optimized fluorescent protein mNeonGreen by using vector pSR25 (synthesized by GenScript, Piscataway, NJ). Primer pairs AtrR-CoNG MH F (CCCGGTCTTCGACACCA ATGGTCCACCCCACGGTGGATTGGCTGGTGCCGGTGCTGGT ...
-
bioRxiv - Biophysics 2022Quote: ... The fusion protein MBP-Q44-HttEx1 was subcloned into a pMalc2x plasmid by Genscript. The protein expression was done in Escherichia coli BL21(DE3 ...
-
bioRxiv - Microbiology 2023Quote: Full-length wMel WalE1 and wAna FtsZ protein-encoding constructs were synthesized by GenScript using codons optimized for E ...
-
bioRxiv - Cell Biology 2023Quote: ... DCP-Bio1-bound proteins were pulled down with Streptavidin-coated magnetic beads (Genscript #L00936) overnight at 4 °C following manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... MgR protein was purified by passing through a column Nickle resin (GenScript Biotech Co.) and washed by using 3 column volumes of wash buffer (50 mM Tris-HCl at pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: The full recombinant MPL36 protein (rMPL36/aa 41-321) was commercially produced by GenScript® Biotech with His-tag in an E ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Immunology 2023Quote: ... supernatants containing the monoclonal antibodies were purified using protein A magnetic beads (Genscript, L00695). The purified samples were determined by SDS-PAGE.
-
bioRxiv - Biochemistry 2024Quote: ... Digested product was bound to 500 µL of protein A resin beads (GenScript #L00210) overnight at 4℃ on a rotating shaker ...
-
bioRxiv - Microbiology 2024Quote: ... and synthetic fragments and genes encoding the fluorescent proteins from Genscript (Supplementary Table 2).
-
bioRxiv - Biophysics 2020Quote: The cDNA sequences for the protein variants used in the study were purchased from GenScript and the proteins were N-terminally tagged with a 6xHis-Lipo domain ...
-
bioRxiv - Immunology 2021Quote: ... GST-tagged NSUN2 proteins were purified by affinity chromatography using reduced glutathione resin (GenScript, L00206) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... The sonicated DNA-Protein complexes were immunoprecipitated with the following antibodies: control IgG (A01008, GenScript), anti-TFAP2C (sc-12762 ...
-
bioRxiv - Microbiology 2019Quote: ... The blot was washed and secondary antibody (for Ryp proteins: Goat α-rabbit HRP (GenScript) 1:1,000 ...
-
bioRxiv - Biochemistry 2021Quote: Codon-optimized open reading frames for EuRe and BoMoC RT proteins were ordered from GenScript. Proteins were produced in Escherichia coli by expression from MacroLab vector 2bct with a C-terminal 6xHis tag (https://qb3.berkeley.edu/facility/qb3-macrolab/#facility-about ...
-
bioRxiv - Microbiology 2021Quote: Polyclonal Rabbit antibodies against the potential S-Layer protein of A_DKE were generated by GenScript Biotech B ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV2 Spike protein (100 nM, S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ), EG00229 (Cat#6986 ...
-
bioRxiv - Plant Biology 2021Quote: ... Accumulation of FHT-HA protein was assayed by immunoblot with a monoclonal HA antibody (GenScript).
-
bioRxiv - Microbiology 2020Quote: ... The expression of each anti-HIV-1 CAR was detected by protein L-biotin (GenScript) and Alexa488-conjugated anti-human Fc antibody or APC-conjugated anti-human Fc antibody as described elsewhere [78] ...
-
bioRxiv - Cell Biology 2020Quote: Our RAD-51 antibody was generated from a His-tagged fusion protein expressed by Genscript from plasmid pET30a containing the entire RAD-51S coding sequence (1385 bp ...
-
bioRxiv - Biochemistry 2021Quote: ... 15 μg total protein was loaded and resolved on Bis-Tris 4-12% gels (GenScript) and transferred to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Immunology 2022Quote: ... vaccines consisted of either SARS-CoV-2 Spike RBD WH-01 protein (GenScript; cat# Z03483) or SARS-CoV-2 WH-01 Spike protein (Acro Biosystems ...
-
bioRxiv - Microbiology 2021Quote: Microtiter plates (96-well; Thermo) were coated with 1 μg/mL S-2P protein (Genscript) corresponding to the S protein of the Wuhan-Hu-1 virus ...