Labshake search
Citations for GenScript :
251 - 300 of 725 citations for Siglec 5 Human HEK293 His Flag Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... FLAG-tagged hZP3 and HA-tagged hZP4 were synthesized (GenScript; GeneArt/Thermo Fisher Scientific) and subcloned into pHLsec329 ...
-
bioRxiv - Immunology 2021Quote: ... Enriched B cells were stained with Flag tagged SARS-CoV-2 spike (Genscript, Z03481) then incubated with APC conjugated anti-Flag and PE conjugated anti-Flag for double staining ...
-
bioRxiv - Neuroscience 2022Quote: ... FLAG-tagged wildtype CDK6 and CDK6pA197T cDNA was cloned into in pcDNA3.1 by GenScript.
-
bioRxiv - Biochemistry 2020Quote: ... or into pcDNA3.1-(+)-N-DYK (nsp2) to append an N-terminal FLAG tag (GenScript).
-
bioRxiv - Cell Biology 2019Quote: Flag-tagged TRMT6 and TRMT61A mammalian expression vectors were purchased from Genscript (Piscataway, NJ). Two additional Flag tags where inserted into the vector coding TRMT61A ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti-FLAG agarose beads and streptavidin-affinity magnetic beads were from Genscript (Nanjing, Jiangsu); Protein A/G magnetic beads were from Thermo Fisher Scientific.
-
bioRxiv - Biophysics 2022Quote: ... The clarified lysate was then incubated with 125 µL of G1 Flag resin (Genscript) per 30 ml culture overnight at 4 °C with rotating before washing with 50 bead volumes of lysis buffer ...
-
bioRxiv - Microbiology 2022Quote: ... The following primary antibodies were used at 1:5000 dilution: anti-FLAG antibody (GenScript), and anti-GAPDH antibody (Proteintech) ...
-
bioRxiv - Neuroscience 2023Quote: ... Complex was eluted using wash buffer supplemented with 0.2 mg/ml Flag peptide (Genscript). Eluent was concentrated and injected to a Superdex 200 increase 10/300 GL column (GE Healthcare ...
-
bioRxiv - Cell Biology 2023Quote: ... FLAG-VHP-sequon-VHP-K20-GFP-HA was ordered as a gene block (Genscript) and inserted into a pcDNA3.1 parent vector containing a CMV promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... membranes were incubated with either anti-FLAG antibody conjugated to iFluor 488 (GenScript A01809) at 1:2,000 dilution ...
-
bioRxiv - Biophysics 2023Quote: ... We loaded the supernatant into a pre-equilibrated anti-FLAG (M2) affinity column (GenScript) at 4 °C and washed the affinity gel with buffer B (20 mM HEPES ...
-
bioRxiv - Immunology 2024Quote: ... and incubated with FITC conjugated anti-FLAG mouse monoclonal antibody (GenScript, Cat. No. A01632) at a concentration of 2 µg per million cells for 1 hr at 37 C in the dark ...
-
bioRxiv - Molecular Biology 2021Quote: ... All purification steps were monitored either by Coomassie-stained SDS-PAGE or anti-HIS western blot (Genscript #A00186). HMT assays were essentially performed as described in (Frapporti et al. ...
-
bioRxiv - Cell Biology 2021Quote: N-terminally Histidine (His)-tagged Bin1b SH3 from zebrafish was cloned into pET-28a (+) expression vector (GenScript®). Full length zebrafish Cavin4a (Cavin4a-FL ...
-
bioRxiv - Biophysics 2022Quote: ... then synthesized and cloned into the pET26b(+) vector in frame with an C-terminal 6 × His tag (GenScript). BL21 DE3 cells were transformed with the plasmid and grown at 37°C in TB media supplemented with 1 mM MgCl2 ...
-
bioRxiv - Microbiology 2020Quote: ... and then incubated with 45 μL each of 0.1 μg/mL of THE anti-his-HRP (GenScript, A00612) in PBST/BSA for 1 hr at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: Codon optimized human SHIP164 generated by Genscript was amplified using PCR from the pUC57 plasmid and ligated into various mammalian and bacterial expression plasmids ...
-
bioRxiv - Neuroscience 2022Quote: Human Stathmin expression clones were from Genscript (STMN1-OHu14092D ...
-
bioRxiv - Biophysics 2022Quote: Isoform 1 of human SERINC2 (GenScript-OHu23082D) was cloned into pFastBacI with the TEV and STREP cleavage and affinity tags upstream of the gene encoding hSERINC2 ...
-
bioRxiv - Microbiology 2021Quote: ... ECD or those with desired ACE2 mutations were fused to the codon-optimized synthetic IgG1 Fc (GenScript) in which GASDALIE or LALA mutations were incorporated ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.04-0.32 picomoles of Tspan12-1D4 and 0.25-2 picomoles of 7xHis-MSP1D1 were probed by Rho anti-1D4 and THE anti-His (GenScript) antibodies respectively ...
-
bioRxiv - Neuroscience 2022Quote: ... A FLAG-tagged eukaryotic expression vector for murine proSAAS was constructed by Genscript (Piscataway, NJ) in pcDNA3.1(- ...
-
bioRxiv - Biochemistry 2021Quote: ... the cells were transfected with pcDNA3.1-spike-V5 with or without pcDNA3.1-GALNTs-FLAG (Genscript) using Lipofectamine 3000 reagent (Invitrogen ...
-
bioRxiv - Biochemistry 2019Quote: ... 26S proteasome was eluted with 26S lysis buffer + 0.5 mg/mL 3X FLAG peptide (Genscript). FLAG eluate was cleaved with HRV protease added in excess ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pcDNA3.1-FLAG-FNIP1 and the pcDNA3.1+N-eGFP-FLCNΔE510 vectors were generated by Genscript. The pIRES2-FLCN plasmids were kindly provided by Dr ...
-
bioRxiv - Molecular Biology 2021Quote: ... the supernatant containing the target proteins was loaded onto anti-FLAG G1 affinity resin (Genscript). The resin was washed using buffer A (20 mM Tris ...
-
bioRxiv - Cell Biology 2022Quote: Tg-FLAG in pcDNA3.1+/C-(K)-DYK plasmid was purchased from Genscript (Clone ID OHu20241). The Tg-FLAG gene was then amplified and assembled with an empty pcDNA5/FRT expression vector using a HiFi DNA assembly kit (New England BioLabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids expressing the PABPN1- Flag (NM_004643) and THOC5-HA (NM_001002878.1) proteins were purchased from GenScript. Plasmid pcDNA-THOC1-HA was generated by cloning the THOC1 sequence from plasmid phHpr1-GST (Addgene #11200 ...
-
bioRxiv - Immunology 2022Quote: ... Fractions containing only trimeric rsHAtCh were then passed over G1 anti-FLAG-agarose resin (Genscript) equilibrated in 10mM Tris ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the pcDNA3.1+-C-(K)-DYK plasmid expressing Flag-EBP was purchased from GenScript (#OHu18817). Primers for site-directed mutagenesis of the EBP gene were designed using the QuikChange Primer Design Program (https://www.agilent.com/store/primerDesignProgram.jsp?_requestid=1072141 ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were analyzed by SDS-PAGE and immunoblotting with anti-Flag (anti-DYKDDDDK, Genscript), anti-HA (clone 3F10 ...
-
bioRxiv - Cell Biology 2024Quote: ... Clarified lysates were incubated with 1 mL Anti-DYKDDDDK (FLAG) Affinity Resin (Genscript; Piscataway, NJ) for 2 h at 4 °C and then washed with 10 column volumes (CVs ...
-
bioRxiv - Developmental Biology 2022Quote: ... residues A27-T157), human FZD7 CRD (UniProt: O75084, residues Q33-G170), human FZD8 CRD (UniProt: Q9H461, residues A28-T158) were synthesized (Genscript). Human LRP6 P1E1P2E2 (UniProt ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-human IgG peroxidase conjugated (A00166, GenScript, USA) or anti-mouse IgG peroxidase conjugated (A4416 ...
-
bioRxiv - Cancer Biology 2022Quote: ... murine and human CD20 cDNA expression constructs (GenScript) were transiently transfected into 293T cells using lipofectamine (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2022Quote: The H3F3A and H3F3B human cDNA sequences (GenScript) were cloned by using ClaI and EcoRI restriction enzymes into the pSNAPm plasmid (New England Biolabs) ...
-
bioRxiv - Biophysics 2022Quote: The human PEAK3 gene was synthesized by GenScript and subcloned into the pcDNA4/TO vector with a C-terminal 3xFLAG tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human SENP1 cDNA (ENST00000448372.5) was synthesised by GenScript to contain an N terminal FLAG tag and synonymous siRNA resistance mutations to the exon 6 and 12 siRNA used (see table 1) ...
-
bioRxiv - Biophysics 2022Quote: The gene that encodes human SERINC3 (Genscript-OHu02717D) was inserted upstream of a thrombin protease cleavable linker (LVPRGS ...
-
bioRxiv - Cell Biology 2023Quote: ... human NAP1 cDNA was gene-synthesized (by Genscript) and subcloned into a pGEX-4T1 vector with an N-terminal MBP-tag followed by a TEV cleavage site before wild-type NAP1 (RRID:Addgene_208871) ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Biochemistry 2021Quote: Sic1PY and WW-HECT were purified as previously described10. Human UBE1 (plasmid obtained as a gift from C. Tang, Peking University) and human UBCH5A (obtained from GenScript, China) were expressed as GST fusion proteins from pGEX-4T vectors ...
-
bioRxiv - Biochemistry 2022Quote: ... Wells were washed 3 times in PBS and incubated with 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984) for 1 hour at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: Recombinant mEAK-7 from Sus scrofa (uniprot ID: A0A4X1T484) was synthesized in a pET28 vector with N-terminal 6×His tag (GenScript). ArcticExpress competent cells (Agilent ...
-
bioRxiv - Molecular Biology 2019Quote: Purified ERα LBD containing amino acids 315-545 used by Brzozowski et al for crystallization16 with a his-tag was custom made (GenScript). All reactions were set up in 20 μL reactions in 96 well plates with purified ERα LBD at a concentration of 0.6 μg/μL and 10x SPYRO orange dye (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... The plasmid encoded an N-terminal 8X His-SUMO-tagged hNatD in the pET-21a vector was obtained from Genscript. Library of Pharmaceutically Active Compounds (LOPAC ...
-
bioRxiv - Biochemistry 2020Quote: The full-length human NatD gene was amplified and cloned into a modified pET-21a(+) vector containing an 8x-His-tag and SUMO protease cleavage site at the N-terminus (Genscript). This pET-21a(+)-hNatD construct was transformed into Escherichia coli BL21 (DE3 ...