Labshake search
Citations for GenScript :
251 - 300 of 434 citations for Rat T Cell Surface Glycoprotein CD8 Beta Chain CD8B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Enriched B cells were stained with Flag tagged SARS-CoV-2 spike (Genscript, Z03481) then incubated with APC conjugated anti-Flag and PE conjugated anti-Flag for double staining ...
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were stimulated with synthetic SARS-CoV-2 S peptides pool (Genscript, Cat# RP30020) at the concentration of 2 μg/mL for 12 h and then incubated with 5 μg/mL Brefeldin A (MCE ...
-
bioRxiv - Cell Biology 2022Quote: ... MATα cells were verified by their lack of response to alpha factor (αF, Genscript) and by their ability to mate with MATa cells ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with the recombinant plasmid carrying the human TDP1 gene (GenScript, OHU22350D) using PEI transfection reagent as previously described (Popovic et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... The PAR sensor cell line was generated by cloning the APLF cDNA sequence (Genscript) into the pHR-FUSN-mCh-CRY2WT plasmid (Addgene ...
-
bioRxiv - Immunology 2023Quote: ... Transduced cells were detected by eGFP expression or by an anti-VHH antibody (Genscript) directed against the nanobody constituting the extracellular domain of the CAR and analyzed by flow cytometry.
-
bioRxiv - Bioengineering 2023Quote: ... Cell adhesion was enabled through the incorporation of 1 mM RGD peptide (GCGTGRGDSPG, Genscript) in all hydrogel groups.
-
bioRxiv - Biochemistry 2023Quote: HeLa cells were lentiviral transduced with pLentiCRISPRv2 P-Rex1 guide RNA3 - AGGCATTCCTGCATCGCATC (Genscript SC1678). Forty-eight hours after transduction ...
-
bioRxiv - Neuroscience 2019Quote: ... The GtACR1-EYFP fragment from the p7-GtCAR1 plasmid was swapped in using CloneEZ® PCR Cloning Kit (GenScript) for the myr::GFP fragment in pJFRC177 and the sequence was verified (GenScript) ...
-
bioRxiv - Microbiology 2020Quote: ... Serum LPS concentrations were measured with a ToxinSensor Chromogenic Limulus Amebocyte Lysate (LAL) Endotoxin Assay Kit (GenScript, Piscataway, NJ), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... 6 and 8 were analyzed with the cPass™ SARS-CoV- 2 neutralization antibody detection kit (GenScript, Cat #L00847) to detect any antibodies that neutralize the interaction between the RBDdelta and the ACE2 receptor ...
-
bioRxiv - Cell Biology 2020Quote: ... and endotoxin contamination was tested using a ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, Piscataway, NJ, USA; L00350). All cultures were maintained at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: RBD-ACE2 binding competition assay was developed using the SARS-CoV-2 surrogate virus neutralization test kit (Genscript, NJ). First a 5-fold dilution series of RBD variant starting at 10 μM was prepared in sample dilution buffer in duplicate ...
-
bioRxiv - Cell Biology 2022Quote: ... Endotoxin levels in all preparations were measured using ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, Piscataway, NJ, USA) and were less than 0.05 EU/ml.
-
bioRxiv - Microbiology 2023Quote: ... species-independent surrogate virus neutralization test (sVNT) (cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit, GenScript, the Netherlands). The test was performed as prescribed by the manufacturer using a cut-off of ≥ 30 % for positivity and < 30 % for negativity ...
-
bioRxiv - Immunology 2021Quote: Levels of neutralizing antibodies in serum samples were determined by cPASSTM SARS-CoV-2 neutralization antibody detection kit (GenScript, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... The predicted full-length lincRNA sequences were amplified by PCR and cloned into the pJR1-41XL vector (Moreno, Durán and Ribas, 2000) using the CloneEZ® PCR Cloning Kit (GenScript). Each plasmid was checked by PCR for correct insert size ...
-
bioRxiv - Developmental Biology 2021Quote: ... The ORF was subcloned into the BamH1 site of pCS2+ (pCS2+-sobp) using the Clone EZ PCR cloning kit (GenScript). pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent) ...
-
bioRxiv - Immunology 2022Quote: The neutralizing activity of mouse serum samples was detected by SARS-CoV-2 Surrogate Virus Neutralization Test Kit (L00847A, GenScript). Detections were performed according to manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2020Quote: Secondary assessment of the RBD-ACE2 interaction blocking potential of the isolated nanobodies was performed using the Genscript SARS-CoV-2 Neutralization Antibody Detection Kit (#L00847, Genscript) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR products were flushed by E.Z.N.A ®Cycle Pure Kit Omega Bio-tek (Norcross, GA) and four samples were sequenced by GenScript (Piscataway, NJ). The sequences were identical ...
-
bioRxiv - Immunology 2022Quote: The concentration of endotoxin in CXCL4 stock solutions was measured by Chromogenic LAL Endotoxin Assay Kit (GenScript, cat. No: L00350C) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... followed with the measurement of the level of endotoxin by ToxinSensor Chromogenic LAL Endotoxin Assay Kit (GenScript Biotech Corp., USA). The recombinant α-syn solution was aliquoted before fibrillization and stored at −80°C until use ...
-
bioRxiv - Developmental Biology 2021Quote: ... The shRNA sequences were cloned into the RCAS vector (Supplementary Fig. 2A,B) by homologous recombination using a CloneEZ kit (GenScript) as previously described (Kwiatkowski et al. ...
-
bioRxiv - Immunology 2021Quote: Blocking of the RBD-ACE2 interaction by the mouse sera was assessed using a SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript) (Tan et al ...
-
bioRxiv - Cancer Biology 2022Quote: ... the cfDNA was modified and amplified to prepare the multiplexed paired-end sequencing libraries with the dual index using GenTrack Library Preparation Kit (GenScript). The sequencing libraries were prepared by end-repair ...
-
bioRxiv - Biochemistry 2023Quote: ... The respective plasmids were then purified using a Thermo Fisher Scientific GeneJET Plasmid Miniprep Kit and sent for sequencing (Genscript).
-
bioRxiv - Biochemistry 2023Quote: Remaining samples of sera from corresponding administration routes along with prebleed samples were pooled and passed through a protein A column and the recovered IgGs used in SARS-CoV-2 surrogate virus neutralisation assays (sVNT) 38 using a commercial kit (GenScript).
-
bioRxiv - Bioengineering 2024Quote: ... the endotoxin levels in OVA-ZE and pZR-ELP were quantified by ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript). OVA-ZE and pZR-ELP with low endotoxin levels and endotoxin free water and PBS were used to prepare OVA protein vesicles for in vitro and in vivo studies ...
-
bioRxiv - Molecular Biology 2024Quote: ... Other pAAV-related plasmids were developed by modifying these plasmids using standard molecular biology techniques and the GenBuilder Cloning kit (GenScript). PCR primers and oligonucleotides used were obtained from Integrated DNA Technologies (IDT) ...
-
bioRxiv - Immunology 2024Quote: The concentration of endotoxin in CXCL4 stock solutions was measured by Chromogenic LAL Endotoxin Assay Kit (GenScript, cat. No: L00350C) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: K562 cells expressing luciferase were transfected with a plasmid containing full-length EGFR (#OHu25437D, GenScript) using lipofectamine 2000 according to the manufacturer’s protocol (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: Both Ixodes IRE1α and TRAF2 were codon optimized for expression in human cell lines (GenScript). Primers listed in Supplemental Table 1 were used to amplify full length I ...
-
bioRxiv - Biochemistry 2021Quote: ... the cells were transfected with pcDNA3.1-spike-V5 with or without pcDNA3.1-GALNTs-FLAG (Genscript) using Lipofectamine 3000 reagent (Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: cDNA constructs for expression of recombinant Mac-1 in mammalian cells were generated by GenScript. ITGAM cDNA was cloned into the vector pcDNA3.1/HygroB(+) ...
-
bioRxiv - Biophysics 2022Quote: The mRBD (331-532) codon optimised for human cell expression was synthesized by GenScript (USA) (35) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were arrested in G1 by addition of 10 µg/ml alpha factor peptide (Genscript) for 1.5 hrs ...
-
bioRxiv - Immunology 2021Quote: ... cells were immunostained using a rabbit anti-spike monoclonal antibody (mAb BS-R2B12, GenScript A02058), anti-rabbit IgG peroxidase conjugate ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... fixed cells were incubated with MonoRabTM iFluor 647 Rabbit Anti-Camelid VHH antibody (GenScript A01994) and Hoechst 33342 diluted in blocking buffer for 1 hour at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: A batch of aE11 expressing hybridoma cells were sent to Genscript (GenScript Biotech [Netherlands] B.V.) for commercial Antibody Variable Domain Sequencing following their standard operating procedures ...
-
bioRxiv - Immunology 2023Quote: ... Lentiviral particles for spike transduction were generated by transfecting 293T cells with pMD2.G (Genscript), psPAX2 (Genscript ...
-
bioRxiv - Bioengineering 2023Quote: ... buffer at pH 9 was functionalized with a thiolated cell-adhesive RGD peptide (GenScript, GCGYGRGDSPG) via a Michael-type addition reaction ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies for assay of transfected cells were goat polyclonal anti-HA (1:500, GenScript), and mouse monoclonal anti-FLAG (1:500 ...
-
bioRxiv - Genomics 2023Quote: Cell lysates from HMLE shLuc and shM2 were separated by 4-20% SDS-PAGE (Genscript) and transferred to a PVDF membrane (10600023 GE) ...
-
bioRxiv - Bioengineering 2023Quote: ... dLN cells were restimulated in vitro in the presence of either OVA257-264 peptide (Genscript) at a final concentration of 1 mg/mL ...
-
Srs2 binding to PCNA and its sumoylation contribute to RPA antagonism during the DNA damage responsebioRxiv - Molecular Biology 2024Quote: Cells from log-phase cultures were treated with 5 μg/mL α factor (GenScript RP01002) for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... Target proteins were obtained with purity >85% and endotoxin level <2 EU/mg (LAL Endotoxin Assay Kit, GenScript, Cat. No. L00350). In addition ...
-
bioRxiv - Cell Biology 2022Quote: ... All proteins were tested for size distribution and purity by gel electrophoresis (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and were confirmed for low endotoxin using ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (Genscript). Unfractionated heparin (UFH ...