Labshake search
Citations for GenScript :
251 - 300 of 932 citations for Mouse Translational Activator Of Cytochrome C Oxidase 1 TACO1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Mouse anti-CodY IgG monoclonal antibody (IgG) was generated and purified (Genscript, USA).
-
bioRxiv - Microbiology 2022Quote: ... The primary antibody for Western blot is Mouse-anti-His mAb (GenScript, Cat.No.A00186). The concentration was determined by BCA protein assay with BSA as a standard ...
-
bioRxiv - Biophysics 2023Quote: ... human/mouse codon-optimized genes coding for the identified ChRs were ordered (GenScript, Piscataway ...
-
bioRxiv - Biochemistry 2023Quote: Sequences encoding mouse WT and site-mutated DAG1 were synthesized (GenScript, Piscataway, NJ) and cloned into adeno-associated virus 2/9 (AAV2/9 ...
-
bioRxiv - Genetics 2024Quote: ... HRP-conjugated mouse monoclonal antibody against FLAG was obtained from GenScript (Cat# A01428).
-
bioRxiv - Biochemistry 2022Quote: The human SNX25 open reading frame (ORF) cloned into the pcDNA3.1+-C DYK was obtained from Genscript (NM_031953). This expresses a C-terminally tagged SNX25 (SNX25-FLAG ...
-
bioRxiv - Neuroscience 2019Quote: ... Samples were heated to 95°C for 5 min and resolved on 8-16% Bis-Tris gels (Genscript) before being transferred to PVDF membranes using the Iblot2 Dry blotting system (ThermoFishcer) ...
-
bioRxiv - Biochemistry 2020Quote: ... Full-length codon-optimized yeast HSP104 fused C-terminally to an HA-tag was expressed from pcDNA3.1 (Genscript). Human codon-optimized HSPH1 fused C-terminally to a Myc-tag was expressed from pcDNA3.1 (Genscript) ...
-
bioRxiv - Biophysics 2020Quote: The C-terminal sequence of the envelope protein (residues 41–75, [NH2]-AYCCNIVNVSLVKPSFYVYSRVKNLNSSRVPDLLV-[COOH]) was obtained from Genscript USA Inc. ...
-
bioRxiv - Biochemistry 2022Quote: Peptides used for co-crystallization were synthesized and amidated at the C-terminus (Genscript, RIKEN Research Resource Center). Peptide used for fluorescence polarization assays were synthesized with an additional N-terminal 5-FAM.
-
bioRxiv - Immunology 2022Quote: ... and incubated at 37°C with different concentrations (10 μM, 2.5 μM and 0.0625 μM) of synthetic peptides (GenScript) or chymotrypsin-digested gluten (100 μg/ml ...
-
bioRxiv - Biophysics 2022Quote: ... then synthesized and cloned into the pET26b(+) vector in frame with an C-terminal 6 × His tag (GenScript). BL21 DE3 cells were transformed with the plasmid and grown at 37°C in TB media supplemented with 1 mM MgCl2 ...
-
bioRxiv - Biochemistry 2021Quote: Full length SARS-CoV-2 nsp3 was codon optimized and cloned into a pcDNA-(+)-C-DYK vector (Genscript). Truncations were performed using primers listed in Table 1 ...
-
bioRxiv - Microbiology 2019Quote: ... Lysate supernatants were incubated overnight at 4°C with anti-flag monoclonal antibody coated on agarose beads (Genscript). The beads were then washed five times in wash buffer (50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Microbiology 2021Quote: The CAN97-83 HMPV N0-P construct with a 6X C-terminal His6-tag was synthesized by GenScript in the pET-29b(+ ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Pathology 2022Quote: ... Jagged-1 peptide (1 uM, Genscript), Y-27632 (10 uM ...
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Microbiology 2021Quote: ... Western blot using a mouse anti-Histidine tag monoclonal Antibody (Genscript Cat. No. A00186) was used to confirm purity of the purified protein (Figure-1S) ...
-
bioRxiv - Microbiology 2022Quote: ... which were coated in anti-HIS antibody [Biotin] (GenScript A00613, mouse IgG1k clone 6G2A9) at 2.5 μg/mL ...
-
bioRxiv - Biophysics 2022Quote: ... Biotin-labeled mouse monoclonal antibody against the Strep-tagII (“NWSHPQFEK”) was purchased from Genscript (GenScript Cat# A01737 ...
-
bioRxiv - Biochemistry 2020Quote: A custom-made mouse monoclonal antibody against the isoDGR motif was prepared by GenScript Corporation (Piscataway ...
-
bioRxiv - Cell Biology 2020Quote: To generate pLenti-mTomm70A-EGFP the open reading frame of mouse Tomm70A (GenScript OMu13526) was amplified via PCR and inserted into pcDNA-EGFP introducing a ten amino acid long linker between mTomm70A and EGFP (GGSGDPPVAT) ...
-
bioRxiv - Cell Biology 2020Quote: ... To generate pLenti-mTimm50-mRFP the open reading frame of mouse Timm50 (GenScript OMu13400) was amplified via PCR and inserted into pcDNA-mRFP introducing a ten amino acid long linker between mTimm50 and mRFP (GGSGDPPVAT) ...
-
bioRxiv - Microbiology 2020Quote: Mouse mAb 10G6H5 against SARS-COV2 S protein was purchased from GenScript (Piscataway, NJ). Rabbit antisera against the S1 subunit ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse alpha-DG N terminal domain(a-DGN) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Immunology 2024Quote: ... and incubated with FITC conjugated anti-FLAG mouse monoclonal antibody (GenScript, Cat. No. A01632) at a concentration of 2 µg per million cells for 1 hr at 37 C in the dark ...
-
bioRxiv - Neuroscience 2021Quote: ... scrambled C1.2 (AATRSTFASKTLIS) were synthesized with a Tat sequence (YGRKKRRQRRR) at the C-terminal by GenScript (Piscataway, NJ, USA). Scrambled sequences were confirmed to not match other protein sequences in mice by Blast search.
-
bioRxiv - Molecular Biology 2019Quote: ... Clone OHu31338D containing the open reading frame of the human ALKBH3 in pcDNA3.1 with C-terminal FLAG tag was obtained from GenScript, U.S.A ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 variant spike constructs with N- and C-terminal flag tags were produced and cloned into a pcDNA3.1 vector by GenScript Biotech (Piscataway ...
-
bioRxiv - Cell Biology 2022Quote: ... the coding sequence of PlyA2 (accession number AB777517) fused to mCherry at the C-terminus was synthesized by GenScript® ...
-
bioRxiv - Cell Biology 2022Quote: ... the coding sequence of PlyA2 (accession number AB777517) fused to mCherry at the C-terminus was synthesized by GenScript® ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmids harboring C-terminally Flag-tagged wild-type or mutant human TDP-43 and p38α sequences in the pcDNA3.1+/C-(K)-DYK mammalian expression vector were purchased from Genscript and PRMT1 plasmid was purchased from Origene ...
-
bioRxiv - Cancer Biology 2022Quote: pcDNA3.1+C-HA Trp53 (OMu22847) and pcDNA3.1+C-FLAG Ppia (OMu14516) plasmids used in mammalian over-expression experiments were purchased from Genscript. The detailed information regarding plasmid constructions is available by request ...
-
bioRxiv - Cell Biology 2022Quote: ... The C-terminal BAP tag of localized mitosomal proteins was detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal marker GL50803_9296 was detected by a rabbit anti- GL50803_9296 polyclonal antibody (3) ...
-
bioRxiv - Biochemistry 2023Quote: The Fis1 N-terminal arm peptide (MEAVLNEL) with N-terminal acetylation and C-terminal amidation were purchased from GenScript who determined the peptide to be >95% pure by HPLC ...
-
bioRxiv - Biochemistry 2023Quote: ... Then the samples were boiled at 95°C for 15 min and run on 4-20% polyacrylamide gels (GenScript).
-
bioRxiv - Biochemistry 2023Quote: ... vector with eGFP on C-terminal and GII.4 VPg was cloned in pcDNA3.1(+) vector with mCherry on N-terminal by Genscript U.S.A ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were treated with 5 μM of recombinant (PR)20 peptides (with a C-terminal HA epitope tag, Genscript) for 10 days ...
-
bioRxiv - Immunology 2022Quote: ... fused at the C-terminus to the Fc region of human IgG1 and cloned into pcDNA3.1(+) vector by Genscript.
-
bioRxiv - Microbiology 2023Quote: ... The following plasmids were used in this study: FLAG tagged ORFs in pcDNA3.1+/C-(K)DYK were purchased from Genscript: CDK1 (NM_001786.5) ...
-
bioRxiv - Biochemistry 2023Quote: The genes encoding full-length TcdB toxin variants (TcdB1,3 and 4) were synthesized with a C-terminal His-tag and cloned into pC-His 1622 by Genscript. The pC-His1622 vector was purchased from MoBiTec ...
-
bioRxiv - Microbiology 2024Quote: A DNA fragment encoding ELC07 Fab heavy chain with a C-terminal hexahistidine (His6) tag and subcloned into pcDNA3.1 was generated by GenScript. The constructs used for expression of stabilised trimeric HIV-1 Env (BG505 SOSIP.664 ...
-
bioRxiv - Cell Biology 2023Quote: The human Calpain 3 and 21 bp-deletion Calpain 3 mutant were synthesized and sub-cloned in the pcDNA3.1 vector containing a C-terminal FLAG tag by GenScript. Wild-type and deletion mutant plasmid constructs for Drosophila Calpain A and Calpain B were synthesized and sub-cloned in the pUASTattb vector to generate transgenic Drosophila lines from BestGene.
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Molecular Biology 2022Quote: ... Selected mouse IgG and IgK chains were cloned into humanized IgH and IgL vectors (Genscript).
-
bioRxiv - Biochemistry 2022Quote: ... for >5 min at room temperature and incubated with mouse anti-His antibody (Genscript A00186) at 0.1 µg/ml in EveryBlot buffer for 1 hr at room temperature or overnight at 4 °C ...