Labshake search
Citations for GenScript :
251 - 300 of 587 citations for Mouse NXPE4 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... anti-Protein C (mouse, Genscript, A01774, 1:1000), anti-α-tubulin (mouse ...
-
bioRxiv - Biochemistry 2023Quote: ... Mouse PANX1 (UniprotID: Q9JIP4) was synthesized by GenScript and subcloned into the pEGC Bacmam vector(41) ...
-
bioRxiv - Genomics 2019Quote: ... Pax6 or Syt4 (RNA synthesis, subcloning and plasmid sequencing were performed by GenScript, Netherlands) (Figure 3-Supplementary data (2)) ...
-
bioRxiv - Biochemistry 2020Quote: ... 293T cells were transiently transfected with plasmids expressing SARS-CoV-2 spike protein (GenScript MC_0101081 ...
-
bioRxiv - Microbiology 2021Quote: ... synthesized and cloned into the Gal-inducible plasmid pESC-URA by GenScript (Piscataway, NJ). Briefly ...
-
bioRxiv - Immunology 2020Quote: Plasmids encoding cDNAs for hMPV F proteins listed in Table S1 were synthesized (GenScript) and cloned into the pcDNA3.1+ vector ...
-
bioRxiv - Microbiology 2021Quote: The other transfer plasmids pΔEP153R-VP30mNG and pΔEP153RΔEP402R-VP30mNG were synthesized commercially (Genscript, US). Plasmid pΔEP153R-VP30mNG contains the left and right flanking regions of EP153R ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA copy number/mL supernatant was assessed using pCDNA3.1(+)-N-eGFP plasmid (GenScript) as standard.
-
bioRxiv - Microbiology 2019Quote: ... Primer synthesis and the sequencing of PCR products or plasmids were performed by Genscript Biotech (Nanjing ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA sequences ligated into pX458 (pSpCas9 BB-2A-GFP) plasmids were purchased from GenScript. Transfections were performed with TransitIT-293 (Mirus Bio ...
-
bioRxiv - Microbiology 2021Quote: A HMPV minigenome plasmid containing Gaussia/Firefly luciferases was designed and synthesized by Genscript, cloned in pUC57 vector ...
-
bioRxiv - Immunology 2022Quote: ... For the Delta variant a full-length plasmid was acquired from GenScript (Piscataway, NJ) and then truncated by in-house PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... BNIP3_OMu13517D or Cdc42_OMu16203C_cDNA expression plasmids were synthesized by a commercial entity (GenScript USA Inc). NDRG1_OMu19504D and BNIP3_OMu13517D were each cloned into a pcDNA3.1+/C-(K)-DYK vector ...
-
bioRxiv - Biophysics 2022Quote: ... The fusion protein MBP-Q44-HttEx1 was subcloned into a pMalc2x plasmid by Genscript. The protein expression was done in Escherichia coli BL21(DE3 ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids containing REDRAW constructs and guide RNA were either ordered and prepared by Genscript or cloned in house utilizing the Bioxp™ ...
-
bioRxiv - Neuroscience 2023Quote: Custom human TauB and TauE plasmids were created on a pET29b backbone by GenScript on a fee-for-service basis ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with the recombinant plasmid carrying the human TDP1 gene (GenScript, OHU22350D) using PEI transfection reagent as previously described (Popovic et al. ...
-
bioRxiv - Neuroscience 2023Quote: AAV9 and the BI-hTFR1 Rep-Cap plasmids were generated by gene synthesis (GenScript). The CAG-WPRE-hGH pA backbone was obtained from Viviana Gradinaru’s lab through Addgene (#99122) ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length human LRRC4B (OHu30422) and PTPRF (OHu02063) plasmid DNAs were purchased from GenScript.
-
bioRxiv - Biochemistry 2024Quote: Wildtype (6x)His-MBP-EWSR1 gene was commercially synthesized in a pUC19 plasmid (Genscript). His-MBP-EWSR1 was inserted into a modified pGEX-6P-2 expression vector by restriction cloning with BsiWI and EcoRI restriction enzymes ...
-
bioRxiv - Immunology 2024Quote: Cxcr6 expressing plasmid was generated by cloning Cxcr6 gene block amplified from ORF (GenScript) into MSCV-IRES-GFP backbone (Addgene # 20672) ...
-
bioRxiv - Cancer Biology 2024Quote: The pcDNA5/FRT/TO-Myc-FEN1 WT and E359K plasmids were synthesized by Genscript and include siResistance to FEN1 exon 2 siRNA GAUGCCUCUAUGAGCAUUUAU ...
-
bioRxiv - Immunology 2024Quote: ... All segments were cloned into a bi-directional transcription plasmid derived from pUC57 (Genscript) including polymerase (Pol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 1:200 iFluor647-conjugated mouse anti-His (Genscript A01802) for civet ACE2 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were stained with mouse anti-HA antibody (Genscript) diluted 1:500 in PBS supplemented with 0.5% goat serum and 0.01% Tween-20 (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... Flag-tag specific mouse antibody (Genscript, catalog no: A100187) and HA-tag specific rabbit antibody (Cell Signaling ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-Clorf109 monoclonal antibody was purchased from Genscript company (Nanjing ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the mouse anti-His (A00186, GenScript, 1:5000 diluted), and the rabbit anti-HA (902303 ...
-
bioRxiv - Cell Biology 2021Quote: ... the mouse anti-FLAG was from Genscript (Nanjing, Jiangsu). FITC-conjugated goat anti-mouse ...
-
bioRxiv - Cancer Biology 2022Quote: The open reading frame of mouse GPx2 (GenScript NM_030677.2) was subcloned by PCR into Xho1/BamH1 restriction sites of lentiviral expression vector pLVX-puro (Clontech) ...
-
bioRxiv - Microbiology 2022Quote: ... or mouse anti-FLAG antibody (anti-DYKDDDDK antibody, Genscript) with Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2023Quote: Recombinant mouse interleukin-11 (rmIL11) (Z03052, Genscript, Oxford, UK) was dissolved in phosphate-buffered saline (PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... The mouse Tmem63b gene (NM_198167) was synthesized by GenScript.
-
bioRxiv - Cancer Biology 2021Quote: K562 cells expressing luciferase were transfected with a plasmid containing full-length EGFR (#OHu25437D, GenScript) using lipofectamine 2000 according to the manufacturer’s protocol (Invitrogen) ...
-
bioRxiv - Biophysics 2020Quote: A plasmid containing the bacterial codon optimized sequence of ORF11-338 was synthesized by GenScript in the pUC57 cloning vector (Supporting Material) ...
-
bioRxiv - Genomics 2022Quote: Synthesised promoter sequences were ordered as plasmids containing att sites for Gateway cloning from GenScript, and reporter transgenes constructed using three-site Gateway cloning (Invitrogen) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmid pHis1522 encoding his-tagged TcsL was synthesized and codon optimized for Bacillus megaterium (Genscript). To express and isolate recombinant TcsL ...
-
bioRxiv - Evolutionary Biology 2022Quote: DNA library containing seven random nucleotides was designed and cloned into pUC18 plasmid by Genscript. This random library was transformed in XL1blue E ...
-
bioRxiv - Immunology 2021Quote: ... VH sequences were also cloned into plasmids containing the IgA1 or IgA2 constant region (Genscript). Recombinant IgA was expressed without a J chain (to express only monomeric IgA ...
-
bioRxiv - Neuroscience 2021Quote: ... the plasmid with codon optimized GCaMP7b under the EF1a promoter was constructed by GenScript (www.GenScript.com). Injections were performed as previously described72 with the following modifications ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid encoding for SARS-CoV-2 RBD was synthesized commercially (Genscript, Piscataway, NJ, USA). Recombinant RBD proteins were produced in transfected FreeStyle 293F cells (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Bacterial optimised expression plasmids for Ym1 and Ym2 were purchased from (Genscript, Piscataway, NJ, USA). Plasmids were then transfected into competent E ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids for alpha-actinin-4 FRET-based tension sensors were synthesized and sequenced by Genscript. Alpha-actinin-4 sstFRET408 was constructed by inserting the sstFRET module between 408aa and 409aa of human alpha-actinin-4 (XP_016882820.1) ...
-
bioRxiv - Cell Biology 2022Quote: Tg-FLAG in pcDNA3.1+/C-(K)-DYK plasmid was purchased from Genscript (Clone ID OHu20241). The Tg-FLAG gene was then amplified and assembled with an empty pcDNA5/FRT expression vector using a HiFi DNA assembly kit (New England BioLabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids expressing the PABPN1- Flag (NM_004643) and THOC5-HA (NM_001002878.1) proteins were purchased from GenScript. Plasmid pcDNA-THOC1-HA was generated by cloning the THOC1 sequence from plasmid phHpr1-GST (Addgene #11200 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the pcDNA3.1+-C-(K)-DYK plasmid expressing Flag-EBP was purchased from GenScript (#OHu18817). Primers for site-directed mutagenesis of the EBP gene were designed using the QuikChange Primer Design Program (https://www.agilent.com/store/primerDesignProgram.jsp?_requestid=1072141 ...
-
bioRxiv - Microbiology 2023Quote: ... The following gRNA sequence targeting ATF3 was cloned into plentiCRISPRv2 plasmid: 5’-CCACCGGATGTCCTCTGCGC-3’ (Genscript). HEK293FT cells were co-transfected with pLentiCRISPRv2-ATF3 CRISPR gRNA ...
-
bioRxiv - Biochemistry 2023Quote: A pcDNA 3.1 plasmid containing the full length human cytoglobin gene was purchased from GenScript. The empty vector control and specific point mutations of this plasmid were also generated by GenScript ...
-
bioRxiv - Genomics 2023Quote: The ACE2 coding sequence was synthesized by PCR amplification from the pUC57-ACE2 plasmid (GenScript). We included a NheI restriction site at the 5’ terminus and a PmeI restriction site at the 3’ terminus ...
-
bioRxiv - Biochemistry 2023Quote: ... The Galectin1 and Endo F3 gene were synthesized and cloned to pET28a plasmid by GenScript Corporation ...