Labshake search
Citations for GenScript :
251 - 300 of 960 citations for Human Gap Junction Alpha 8 Protein CX50 GJA8 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... 293F cells were transfected with plasmids containing Spike protein (ATUM plasmid pD2528-CMV with insert QHD43416.1) and Spike-2P protein (site-directed mutagenesis to generate the 2P mutation on the plasmid containing Spike protein, GenScript) by 293fectinTM transfection reagent (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag-171Yb (clone HPC4, Genscript), anti-mCherry-142Nd (Abcam) ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag-171Yb (clone HPC4, Genscript), anti-mCherry-142Nd (Abcam) ...
-
bioRxiv - Biochemistry 2020Quote: ... and 0.2 mg/mL Protein C peptide (Genscript), and concentrated on a Vivaspin 50-kDa concentrator.
-
bioRxiv - Molecular Biology 2022Quote: ... All custom recombinant proteins were synthesised by GenScript using a mammalian expression system.
-
bioRxiv - Molecular Biology 2021Quote: ... Purified FMO-2 protein was purchased from GenScript. Purified FMO5 protein ...
-
bioRxiv - Microbiology 2021Quote: ... eBlot L1 –Fast Wet Protein Transfer System (GenScript) was used for blotting and proteins were stained using the following antibodies ...
-
bioRxiv - Microbiology 2020Quote: ... the proteins were transferred to nitrocellulose membrane (Genscript) by the Genscript eBLOT L1 fast wet protein transfer system ...
-
bioRxiv - Microbiology 2020Quote: ... The protein was cleaved using bovine enterokinase (GenScript) leaving a FLAG-tag at the C-terminus of the RBD ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were resolved on 4%-12% (GenScript, M00654) or 4%-20% (GenScript ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 Spike RBD protein (GenScript #Z03479) was immobilized on high-absorbency 96-well plates at 5 ng/mL and incubated at 4°C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... or rabbit anti-protein C (1:3000, GenScript) as primary antibodies ...
-
bioRxiv - Biochemistry 2024Quote: Plasmids for protein expression were ordered from Genscript (gene synthesis ...
-
bioRxiv - Immunology 2023Quote: ... Protein A/G beads (Genscript, Nanjing, Jiangsu, China) were subsequently added to the mixtures and incubated for another 5 h ...
-
bioRxiv - Biochemistry 2023Quote: ... before incubation with Protein A Resin (Genscript, China) at room temperature for 2 h for antibody affinity purification ...
-
bioRxiv - Immunology 2022Quote: ... or S-protein peptide pool (Genscript, # RP30020, USA) or S-protein (B.1.351 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-Protein C (mouse, Genscript, A01774, 1:1000), anti-α-tubulin (mouse ...
-
bioRxiv - Biochemistry 2024Quote: ... The eluted protein was cleaved with PreScission (GenScript) protease by dialysis and run over a second glutathione affinity column ...
-
bioRxiv - Molecular Biology 2023Quote: ... were designed using the p100pop consensus sequence (accession number KC595609.1, [8]. The sequences were commercially synthesized and cloned into a pUC57 vector (GenScript). The plasmid p100NGS_coding_FLAG_PS (accession number OQ726015 ...
-
bioRxiv - Immunology 2022Quote: EAE was induced by immunization of 8-12 week-old mice with 200 μg of MOG35-55 peptide (GenScript) emulsified in complete Freund’s Adjuvant (400 μg desiccated Mycobacterium tuberculosis H37 Ra mixed with incomplete Freund’s adjuvant (BD Biosciences)) ...
-
bioRxiv - Immunology 2021Quote: ... Antigens included recombinant SARS-CoV−2 RBD protein obtained from the Saphire laboratory at LJI or recombinant nucleocapsid protein (GenScript Z03488). The next day ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to measure total protein content to enable equal loading of protein onto 4-12% precast mini polyacrylamide gels (SurePAGE™, GenScript). Proteins were transferred onto polyvinyl difluoride (PVDF ...
-
bioRxiv - Microbiology 2024Quote: ... The total natural IgM was purified from the flow through serum from Protein G resin using Protein L resin (GenScript, China).
-
bioRxiv - Biochemistry 2020Quote: The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC ...
-
bioRxiv - Cancer Biology 2022Quote: The cloning service of recombinant human HK1b and HK1c isoforms was performed by GenScript Inc (Piscataway ...
-
bioRxiv - Biochemistry 2021Quote: ... codon optimized human DHFR was produced as a 6His-SUMO1 fusion from pET28a (Genscript).
-
bioRxiv - Immunology 2021Quote: ... Media supplemented with 10 ng/mL of recombinant human VEGF (GenScript, Piscataway, NJ, U.S.) was used as a positive control ...
-
bioRxiv - Immunology 2020Quote: ... human recombinant IL-2 (10 U/well) and with or without SIINFEKL peptide (Genscript) at 0.2ug/ml ...
-
bioRxiv - Neuroscience 2023Quote: Custom human TauB and TauE plasmids were created on a pET29b backbone by GenScript on a fee-for-service basis ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with the recombinant plasmid carrying the human TDP1 gene (GenScript, OHU22350D) using PEI transfection reagent as previously described (Popovic et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Biophysics 2023Quote: The γ1 ORF (human ortholog LRRC26) used in this study was obtained from Genscript database and tagged on the C-terminus with 3C protease ...
-
bioRxiv - Biochemistry 2023Quote: Human Mint1 open reading frame and mutant Mint1(D269A/I270A) were obtained from Genscript and cloned into the pcDNA3.1-N-eGFP ...
-
bioRxiv - Biochemistry 2022Quote: ... the DNA coding for the human LRRK1 residues 20 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCGCTGTGTGTCCAGAACGTGCCATGG and the reverse primer TATCCACCTTTACTGTCACCTTCTCTTGCGAGTGCAAGCCTCC ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Biophysics 2022Quote: The full length human PARP1 cDNA cloned in pET28-a(+) was purchased from GenScript, USA ...
-
bioRxiv - Biochemistry 2022Quote: A codon-optimized open reading frame for Human DSS1 (DSS1) was synthesized (GenScript Inc.) with a SUMO protease cleavable N-terminal MVKIH-Strep-6x-HIS-SUMO tag ...
-
bioRxiv - Immunology 2022Quote: ... the four genes for each multispecific antibody were synthesized using human preferred codons (GenScript) and cloned into eukaryotic expression vectors ...
-
bioRxiv - Cancer Biology 2024Quote: ... oeANXA4: Human ANXA4 (NM_001320698.2) in pcDNA3.1+/C-(K)-DYK vector was purchased from GenScript (GenScript Biotech ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and recombinant human vascular endothelial growth factor-165 (VEGF) were from GenScript (Piscataway, NJ). Basic fibroblast growth factor (bFGF ...
-
bioRxiv - Immunology 2021Quote: Active EAE was induced in 8-10 week old male and female mice by subcutaneous immunization with murine MOG35-55 peptide (Genscript) and complete Freund’s adjuvant ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... a synthetic gene fragment encoding the extracellular region of a metagenomic FsxA ORF (IMG genome 3300000868, scaffold JGI12330J12834_ 1000008, ORF 8; Source Data Table 1) (GenScript) was subcloned by PCR in frame with the 5’ chicken Crypα signal peptide- and 3’ 8xHis-tag-encoding sequences of pLJ6 ...
-
bioRxiv - Immunology 2024Quote: ... rHA was generated from H3N8 Kentucky/91 or H1N1 A/PR/8/34 viruses by overlapping synthesis of oligonucleotides (Genscript) that removed the transmembrane domain of the protein but inserted a flexible glycine/serine peptide spacer ...
-
bioRxiv - Immunology 2021Quote: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA ...
-
bioRxiv - Immunology 2021Quote: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA ...
-
bioRxiv - Molecular Biology 2023Quote: ... A custom RHINO polyclonal antibody was outsourced from GenScript using the recombinant protein described in the “Protein purification section” with 6xHIS tag retained and produced in rabbit (GenScript; 1:1000 dilution). The secondary antibodies were mouse IgG HRP-linked (NA931 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cas9 protein was purchased from Genscript (Cat. No. Z03389). Cas9 protein (12 µg ...
-
bioRxiv - Immunology 2022Quote: Plasmids encoding cDNAs of Pneumovirus proteins were synthesized (GenScript) and cloned into the pcDNA3.1+ vector (30 ...
-
bioRxiv - Immunology 2022Quote: ... and protein G resin (L00209) were purchased from GenScript. Anti-NLRP3 (AG-20B-0014-C100 ...
-
bioRxiv - Bioengineering 2021Quote: RBD protein expressed with AviTag was purchased from GenScript. Site-specific biotinylation of the AviTag was performed using BirA Biotin-Protein Ligase Reaction kit (Avidity) ...