Labshake search
Citations for GenScript :
251 - 300 of 827 citations for Hepatitis E ORF2 protein mouse Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: The recombinant PLpro wild type and mutants’ genes with an N-terminal Hisx6 tag was introduced into the pET-28b (+) bacterial expression vector by GenScript, Inc ...
-
bioRxiv - Biochemistry 2023Quote: Wildtype and mutant PRD-0038 S constructs consisting of residues 1-1235 and containing a 21 residue C-terminal deletion (del21) followed by a 3x FLAG tag were synthesized by GenScript and placed into an HDM plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... and eluted from the column by incubation with either reduced glutathione (to retain the GST tag) or with 10 units Prescission Protease (Genscript) to obtain protein without a tag ...
-
bioRxiv - Biochemistry 2024Quote: ... Equivalent aliquots (15 µL) of each fraction were analysed by SDS-PAGE and immunoblotting using anti-His tag antibody (GenScript) overnight at 4°C as per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Biochemistry 2024Quote: ... fused to consecutive C-terminal HA (hemagglutinin)- and FLAG-tags and cloned into pCDNA-3.1 plasmid for expression in HEK293 cells by the CMV (cytomegalovirus) promoter (GenScript Biotech). Mutant variants were generated by site directed mutagenesis (GenScript Biotech).
-
bioRxiv - Biochemistry 2024Quote: ... and synthesized and cloned into the pET-DUET-1 vector with a C-terminal Tobacco Etch Virus (TEV) protease cleavage site (ENLYFQG) and hexahistidine tag (His6) (GenScript). The expression construct was transfected into E ...
-
bioRxiv - Biophysics 2024Quote: ... or C154Y mutants optimized for expression in yeast were cloned in a pPIC9K vector upstream of a sequence coding for a PreScission protease cleavage site (LEVLFQGP) followed by a linker of 11 amino acids and a 10His tag (GenScript). The plasmids were introduced in Pichia pastoris strain SMD1163 (his4 ...
-
bioRxiv - Biophysics 2024Quote: ... A pET28a(+) plasmid containing an open reading frame for human hnRNPA1 with an N-terminal 6xHis tag was synthesized by GenScript. The 6xHis-hnRNPA1 was expressed in E ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated protein L (GenScript) and the addition of streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Microbiology 2019Quote: ... coli protein production (Genscript) and used as templates for subsequent cloning ...
-
bioRxiv - Immunology 2020Quote: ... synthesized in vitro and subcloned into a pcDNA3.4 vector containing the human IgG1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into a 293-6E expression system ...
-
bioRxiv - Immunology 2021Quote: ... synthesized in vitro and subcloned into a pcDNA3.4 vector containing the human IgG1 or IgA1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into a 293-6E expression system ...
-
bioRxiv - Molecular Biology 2022Quote: IgGFc: Human IgG Fc Sequence (Supplementary Material Figure S1) was codon optimized for HEK293 expression and synthesized from Genscript USA in pUC57 vector ...
-
bioRxiv - Immunology 2022Quote: ... and subcloned into an expression vector containing the human IgG1 or IgA1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into CHO cells ...
-
bioRxiv - Immunology 2022Quote: ... fused at the C-terminus to the Fc region of human IgG1 and cloned into pcDNA3.1(+) vector by Genscript.
-
bioRxiv - Immunology 2024Quote: Cognate VH and VL antibody sequences of interest were synthesized and cloned into a customized pcDNA 3.4 vector containing a human IgG1 Fc region by GenScript Biotech ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Cell Biology 2020Quote: ... in the position of the E-box as well as 1 kb homology arms (60) were created by gene synthesis (GenScript) and cloned into pUC57 ...
-
bioRxiv - Bioengineering 2020Quote: ... was synthesized as gBlocks Gene Fragment from Integrated DNA Technologies Inc. The ATR2 gene (codon optimized for E. coli) was synthesized from GenScript. All strains and plasmids used in this study are listed in Table 1 and 2 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Mpro inhibition assay was performed using the FRET-based fluorescent peptide substrate DABCYL-KTSAVLQ↓SGFRKM-E(EDANS)-NH2 (purchased from Genscript). The assay was standardized with enzyme concentration of 140 nM and 30 µM of fluorescent substrate in Mpro assay buffer containing (20 mM Tris pH 7.3 ...
-
bioRxiv - Biochemistry 2023Quote: ... encoding multidomain protein TwCel5-6 has an accession number WAK85940.1 (codon optimized for E. coli expression using the OptimumGene™ PSO algorithm) was synthesized by GenScript Biotech (Piscataway ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse GPx2 plasmid (GenScript) was subcloned by PCR into Xho1/BamH1 restriction sites of lentiviral expression vector pLVX-puro (Clontech) ...
-
bioRxiv - Biochemistry 2019Quote: ... NPC2 bound to LBPA isomers was detected by incubating the Snoopers with rabbit polyclonal anti-c-myc-tag antibody (RRID: AB_914457, GenScript, Piscataway, NJ) at a concentration of 0.5μg/ml in TBS + 3% BSA for one hour at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... a GlySer-linker and the C-tag flanked by PmeI sites was amplified by PCR from a synthetic fragment provided by GenScript (USA), codon-optimized for expression in a low protease background C1 ...
-
bioRxiv - Biochemistry 2021Quote: ... The cDNAs encoding mCer-mCit sensor or CRONOS were synthesized and subcloned into pET28a vector containing His6 tag (Genscript, NJ, USA).
-
bioRxiv - Biochemistry 2021Quote: Mammalian expression plasmid pcDNA3.1+/C-(K)-DYK carrying the ORF sequence of WT CYP21A2 (NM_000500.7) with a C-terminal DYK (FLAG) tag was purchased from GenScript (New Jersey, USA). We used this plasmid as a template to create the variants through site-directed mutagenesis ...
-
bioRxiv - Biochemistry 2022Quote: The coding sequence of MtDPP was cloned into plasmid pET28a(+)in frame with an N-terminal 6×His tag (GenScript™). BL21 (DE3 ...
-
bioRxiv - Biochemistry 2022Quote: ... coding sequence was synthesised and cloned into a pET28a plasmid with N-terminal His6-tev purification tag (supplied by Genscript Ltd).
-
bioRxiv - Immunology 2023Quote: DNA encoding for residues 24-167 of the extracellular portion of human PD-1 (UniProt Q15116) with a C-terminus histidine tag or corresponding PD-1 N58Q mutant were cloned into pcDNA3.4 by GenScript (Piscataway, NJ). Expi293 cells were transiently transfected with plasmid DNA mixed with PEI (Polysciences ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNAs coding for NSP8 and NSP7 proteins were codon-optimised and custom-synthesised with an N-terminal 6X-His tag in the pET28a vector (Figure S1, GenScript, USA). The NSP12 ...
-
bioRxiv - Molecular Biology 2023Quote: ... AAP13442.1) with N-terminal His6 tags were made by inserting DNA between NcoI and BamHI sites of pET15b (GenScript, Piscataway, NJ). pET15b-His6-Nsp1(SARS CoV2 ...
-
bioRxiv - Biochemistry 2022Quote: Codon-optimized gene corresponding to 5 to 897 amino acids of KFDV NS5 with an N-terminal Hexa-histidine tag was synthesized (Genscript USA) and sub-cloned into pET-28a (+ ...
-
bioRxiv - Plant Biology 2022Quote: Proteins were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and 4%-20% Precast Protein Plus Gel (Yeasen ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein G-Agarose beads (Genscript), Polyetheleneimine reagent (Polysciences ...
-
bioRxiv - Systems Biology 2021Quote: ... reinhardtii CDKB1 protein (Genscript, www.genescript.com)(64) ...
-
bioRxiv - Immunology 2020Quote: ... S1 and N proteins (Genscript) were conjugated onto MagPlex microsphere (Luminex ...
-
bioRxiv - Cancer Biology 2023Quote: ... biotinylated Protein L (GenScript USA) (25) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Bis-Tris Protein Gel (GenScript), and blotted ...
-
bioRxiv - Bioengineering 2023Quote: ... recombinant VZV gE protein (Genscript) diluted in coating buffer (Biolegend ...
-
bioRxiv - Bioengineering 2019Quote: ... The coding sequences of both domains were optimized for codon usage of the host (E. coli BL21) using OptimumGeneTM (GenScript, USA) and a His-Tag was added at the carboxyl end for further purification ...
-
bioRxiv - Biochemistry 2020Quote: A human Kif15 motor domain and neck linker construct (Kif15_MD residues 1-375) in a pET21a vector with a C-terminal 6 x His-tag was generated by chemical synthesis (GenScript, Piscataway, NJ). Six of the eight cysteine residues (C5S ...
-
bioRxiv - Biophysics 2019Quote: ... pET21 vectors containing the inserted sequences for CsgF fused to the plasmid-encoded C-terminal hexahistidine tag were obtained from Genscript (Piscataway, NJ). E ...
-
bioRxiv - Biochemistry 2021Quote: ... were each synthesised with a N-terminal honeybee melittin signal peptide and a C-terminal TEV protease cleavage site and His6-tag by GenScript (Hong Kong) and subcloned into the pFastBac1 vector.
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids for codon-optimized pET-28a- His6-nsp7-8 and pET-28a-His6-nsp7-11 (with an HRV 3C protease cleavage site between the 6x- His tag and the coding sequence) were obtained from GenScript (Piscataway, NJ). Primers used for cloning and mutagenesis ...
-
bioRxiv - Biochemistry 2021Quote: ... plasmid containing the full-length Arabidopsis thaliana Atm3 (AtAtm3) gene with a C-terminal 6x-His tag was purchased from Genscript (Genscript, NJ). Mutagenesis reactions generating the N-terminal 60 ...
-
bioRxiv - Biochemistry 2020Quote: ... fused to the Saccharomyces cerevisiae alpha factor secretion signal (N-terminal)40 followed by a C-terminal Sortase-A recognition sequence and a His6 tag (C-terminal) was synthesized and cloned into pPICZalpha by GenScript (NJ, USA) using EcoRI and SacII restriction sites to produce pPICZalphaA-RBD-Hisx6.
-
bioRxiv - Biochemistry 2020Quote: ... and followed by a C-terminal Sortase-A recognition sequence for covalent coupling39 and a His6 tag for purification (LPETGHHHHHH) was synthesized by GenScript (NJ, USA) and cloned into the pCDNA3.1(+ ...
-
bioRxiv - Cell Biology 2022Quote: ... Coding sequence of SARS-CoV-2 S gene (GenBank: QHU36824.1) fusion with a c-terminal His tag was synthesized in vitro (Genscript, Piscataway, NJ, USA) after an optimization for expression in human cells.16 The sequence was cloned into a pcDNA3.1 vector to obtain pcDNA-Spike.16
-
bioRxiv - Pathology 2020Quote: ... Coding sequence of SARS-CoV-2 S gene (GenBank: QHU36824.1) fusion with a c-terminal His tag was synthesized in vitro (Genscript, Piscataway, NJ, USA) after codon optimization for expression in human cells ...