Labshake search
Citations for GenScript :
251 - 300 of 954 citations for 7 bromo 1 methyl 1 3 dihydro 2H benzo d imidazol 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... labeling with 1:200 biotinylated anti-Strep tag antibody (GenScript) was followed by 1:500 BrilliantViolet 421 conjugated with Streptavidin (Biolegend) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cDNA for hHIPK2 isoform 1 was synthesized by GenScript® to match the NCBI reference sequence NM_022740.4 ...
-
bioRxiv - Microbiology 2020Quote: ... A human chimeric anti-S1 antibody (Genscript; 1:200 dilution) followed by an Alexa647-conjugated goat anti-human IgG (Jackson Laboratories ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μg of the industrial grade GFPxm163-pcDNA3.1(+) plasmid (GenScript), 1.5 μL of Lipofectamine 3000 ...
-
bioRxiv - Immunology 2023Quote: ... THETM V5 Tag antibody (both at 1:5000 dilution, GenScript), and CLIPA8 primary antibody (1:5000 dilution ...
-
bioRxiv - Microbiology 2023Quote: ... phage 1/4 Gad1 was used and synthesized by Genscript. Gad1 and related homologs were cloned into the pSG-thrC-Phspank vector40 and transformed to DH5α competent cells ...
-
bioRxiv - Immunology 2022Quote: ... Omicron BA.1 and BA.5 was performed by GenScript, Nanjing ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Larger mutations (Indels >1 amino acid) were performed by GenScript directly using the previously synthesized construct as a template ...
-
bioRxiv - Immunology 2023Quote: ... and PGT151 and 1-18 IgGs were produced by Genscript based on publicly available sequences.
-
bioRxiv - Biochemistry 2023Quote: ... Depsi Aβ (1–42) peptide (click peptide) (Genscript, ref. RP10017) was dissolved in 0.1% TFA to a final concentration of 200 μM (stock solution ...
-
bioRxiv - Plant Biology 2023Quote: ... and Goat- Anti-Mouse IgG [HRP] (1:3000; GenScript, A00160) secondary antibody ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-pTRKB-Y705 (1:1000; Genscript, Cat. No. A01186).
-
bioRxiv - Immunology 2024Quote: ... Incubation with the primary antibody (rabbit anti-CxVLG-1 (GenScript) generated in [26] ...
-
bioRxiv - Biochemistry 2024Quote: CeEngase (eng-1) gene was cloned into pET28a vector (Genscript). The constructed pET28a-eng-1 plasmid was transformed into E ...
-
bioRxiv - Microbiology 2024Quote: ... custom rabbit anti-JCV N (1:200; Genscript, Y743THG190-16), rabbit anti-Lrp1 (1:500 ...
-
bioRxiv - Molecular Biology 2024Quote: H3K9Me2K14Ac-Biotin (aa 1-19) peptide was purchased from Genscript. The countersalts are hydrochloric salts ...
-
bioRxiv - Microbiology 2024Quote: ... custom rabbit anti-JCV N (1:500; Genscript, Y743THG190-16), mouse anti-βIII-tubulin (1:500 ...
-
bioRxiv - Biochemistry 2024Quote: ... Human Pcdh21 isoform 1 (NCBI accession NP_149091.1) was synthesized (GenScript) and cloned into a pCDNA3.1 vector (Thermo Fisher ...
-
bioRxiv - Biochemistry 2024Quote: ... The 1-420 WIP1 construct was codon optimized by GenScript and was inserted into a pET28b vector with an N-terminal 6-His SUMO tag.
-
bioRxiv - Microbiology 2021Quote: The ability of aptamers to block the association of SARS-COV-2 RBD with ACE-2 was measured with the cPass™ SARS-CoV-2 Neutralization Antibody Detection kit (GenScript®). For comparison ...
-
bioRxiv - Biochemistry 2022Quote: Recombinant mEAK-7 from Sus scrofa (uniprot ID: A0A4X1T484) was synthesized in a pET28 vector with N-terminal 6×His tag (GenScript). ArcticExpress competent cells (Agilent ...
-
bioRxiv - Cell Biology 2021Quote: ... which was synthesized to contain 7 modified TetO elements flanked by two minimal CMV promoter sequences based on pTet-T2 sequences (GenScript) (49) ...
-
bioRxiv - Biochemistry 2020Quote: ... coli codon-optimized version of VC1 coding for an N-terminal His-tag and lacking the predicted cTP-coding region (Supplementary File 7) was synthesized (GenScript) and cloned into expression vector pET22b(+ ...
-
bioRxiv - Biophysics 2020Quote: ... 10 nM NS2B-NS3pro was incubated with the substrate benzoyl-Nle-Lys-Arg-Arg-7-amino-4-methylcoumarin (Bz-nKRR-AMC) (Genscript) at concentrations varying from 2 to 200 µM ...
-
bioRxiv - Microbiology 2022Quote: ... The plasmids were generated by synthesis of Flex-mCherry and Flex-eGFP and inserted into humanized M plasmids described in [7] using EZcloning from Genscript. The SARS-CoV-2 N protein was tagged at the N-terminus ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: Michaelis-Menten kinetics of pre-SplB mutants were measured with the peptide substrate Ac-WELQ-AMC (Ac: acetyl-; AMC: 7-Amino-4-methylcoumarin, stock concentration: 26 mM in DMSO, concentration range: 13-1161 μM, Genscript) at an enzyme concentration of 125 nM to 2.5 μM using a Tecan infinite 200Pro (excitation wavelength 339 nm ...
-
bioRxiv - Molecular Biology 2023Quote: A DNA library (Supplementary Table 6, 7) comprising seven random nucleotides was created and subsequently cloned into the plasmid pUC18 by GenScript. This random library was transformed in XL1blue E ...
-
bioRxiv - Biochemistry 2024Quote: The peptidase activity of the 20S CP was measured using a pair of substrates: the tripeptide benzyloxycarbonyl-Val-Leu-Arg-7-amino-4-methylcoumarin (Z-VLR-AMC, Genscript) and a 11-residue oligopeptide conjugated to 7-methoxycoumarin-4-acetic acid referred to as LF211 (7-methoxycoumarin4-acetic acid (MCA)-Lys-Lys-Val-Ala-Pro-Tyr-Pro-Met-Glu-(dinitrophenyl)diaminopropionyl-NH2 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... SARS-CoV-2 pseudovirus (Genscript) was diluted in DMEM complete media to an IFU of 3.2e7/mL ...
-
bioRxiv - Microbiology 2021Quote: ... ACE-2 –Fc (GenScript Z033484) was diluted at 1.2µg/ml in HBS P+ (Cytiva ...
-
bioRxiv - Genetics 2023Quote: ... Identified homozygous PC-9_ EGFRdel19-ARTi clones were further engineered by cutting endogenous EGFR with a CRISPR all-in-one vector pX458_Exon20_gRNA TAGTCCAGGAGGCAGCCGAA (GenScript) using X-tremeGENE 9 DNA transfection reagent (Roche ...
-
bioRxiv - Immunology 2021Quote: ... at a final concentration of 1 μg/mL per peptide (GenScript). Splenocytes were plated in duplicate at 1×105 cells per well and 2.5×104 cells per well (mixed with 7.5×104 naïve cells ...
-
bioRxiv - Microbiology 2020Quote: Human EnvP(b)1 codon-optimized sequence was ordered from GenScript. EnvP(b)1 sequences from chimpanzee ...
-
bioRxiv - Plant Biology 2021Quote: ... followed by Goat Anti-Mouse IgG [HRP] (1:3000; GenScript A00160) as the secondary ...
-
bioRxiv - Immunology 2022Quote: ... NL63 (YP_003767.1) and WIV-1 (Uniprot – U5WI05) were synthesized from Genscript. HIV-based HcoV spike glycoprotein-pseudotyped viruses were prepared as previously described (70 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: The gene encoding human CDK2 (1-298) was custom-synthesized (GenScript), subcloned into pGEX6P1 vector providing an N-terminal GST-tag and expressed in E ...
-
bioRxiv - Biophysics 2020Quote: ... The Mfd full-length (1–1148) construct was purchased from Genscript in a pET28b(+ ...
-
bioRxiv - Biochemistry 2020Quote: ... 1+/c-(k) - dyk expression vector for mammalian cells by GenScript Corporation (Piscataway ...
-
bioRxiv - Genomics 2021Quote: ... The following antibodies were used: Gcn5 (rabbit polyclonal, 1:1000, (GenScript antibody services ...
-
bioRxiv - Molecular Biology 2021Quote: ... pS23-Ab 1:10,000 (Custom generated by GenScript; peptide sequence-CKILTHYENDSPTDLR). The cells were washed and incubated with secondary antibodies Alexa fluor 488 goat anti-mouse (Thermo fisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... a fragment corresponding to CIP2A (1-560) was cloned by Genscript into pGADT7 AD (Clontech/Takara ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μg of the industrial grade CytERM-GFPxm163-pcDNA3.1(+) plasmid (Genscript), 1.5 μL of Lipofectamine 3000 ...
-
bioRxiv - Microbiology 2023Quote: ... affinity-purified rabbit polyclonal (peptide SSTEPASTGTPSSGC, produced by GenScript, 1:1000), followed by donkey anti-rabbit Alexafluor555 (Invitrogen A31572 ...
-
bioRxiv - Genomics 2024Quote: ... and shRNA oligos for insertion (Table 1) were synthesized by GenScript. Oligos were reconstituted in water at a concentration of 100 μM ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary antibodies used were anti-strep tag (GenScript, A01732, 1/1000), anti-PHF21A (in house ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... with mouse-anti-FLAG-iFluor647 (1:500) (Genscript, Piscataway, NJ, USA) or anti-human IgG Fc Alexa Fluor 647 (1:200 ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit polyclonal anti-AQP4ex (1:2000; GenScript Biotech, Piscataway, NJ, USA), mouse monoclonal anti-OMP (1:1000 ...
-
bioRxiv - Microbiology 2024Quote: ... PCR fragment 1 was amplified from plasmid pUC57-re-ulg8 (GenScript) using primers 5’ box_F and 5’ box_R ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 1 mM dithiothreitol) containing 50 units of PreScission protease (GenScript) was loaded on the column and incubated overnight at 4°C to cleave GST from fascin ...
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Supplementary Table 3) and synthesized in vitro (Genscript). For protein expression ...