Labshake search
Citations for GenScript :
201 - 250 of 1333 citations for N' 4 Dimethylamino phenyl methyl 5 methyl 1 2 oxazole 3 carbohydrazide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: Western blots were performed using ExpressPlus PAGE Gel 4-12% or 4-20% (GenScript). Proteins were transferred to PVDF membranes (MERCK-Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... Gradient gels (4-12% GenScript) were used in all experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4%-20% (GenScript, M00657) precast gradient gels and transferred to a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-12% gel (GenScript, #M00654) and separated by MOPS buffer (GenScript ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA copy number/mL supernatant was assessed using pCDNA3.1(+)-N-eGFP plasmid (GenScript) as standard.
-
bioRxiv - Biochemistry 2021Quote: The gene for N102LT N-terminally fused with tagRFP (gi: 336287738) was synthesised (GenScript) and inserted to unmodified pQlinkN plasmid using restriction enzyme cloning ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse alpha-DG N terminal domain(a-DGN) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Microbiology 2023Quote: Synthetic peptides of P covering the sequence N-EDDIYQLIM-C were obtained from GenScript. The peptide was dissolved in deionised water dosed with a drop of 5 M NH4OH to improve solubility ...
-
bioRxiv - Immunology 2024Quote: ... and N genes were integrated into a lentiviral expression plasmid (pGenlenti vector) from Genscript, UK ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were then probed for SEOV N (α SEOV nucleocapsid, custom generated with Genscript) or HTNV N (anti-HTNV nucleocapsid 76–118 ...
-
bioRxiv - Biochemistry 2022Quote: ... Wells were washed 3 times in PBS and incubated with 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984) for 1 hour at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-Akr1B-2 at 1:100,000 (produced to full-length Drosophila p23 (Q9VH95) by GenScript) and mouse anti-α-Tubulin at 1:5000 (AB_477593 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transferred membranes were incubated with the following primary antibodies overnight at 4°C: DUXBL (1:1000, Custom antibody, GenScript), ZSCAN4C (1:500 ...
-
bioRxiv - Immunology 2023Quote: ... were coated with 1 μg/mL (for IgG) or 5 μg/mL (for IgA) S-2P protein (GenScript), corresponding to the spike protein of the Wuhan-Hu-1 virus stabilized with 2 proline mutations ...
-
bioRxiv - Biophysics 2022Quote: ... All constructs were designed with GFPmut1 fused to the N-terminus and synthesized by GenScript. The plasmids were electroporated into P ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pcDNA3.1-FLAG-FNIP1 and the pcDNA3.1+N-eGFP-FLCNΔE510 vectors were generated by Genscript. The pIRES2-FLCN plasmids were kindly provided by Dr ...
-
bioRxiv - Biophysics 2020Quote: ... and FEZ1 peptide (M174-L188, with N-terminal extension containing a cysteine residue (KCGGSGGMMQNSPDPEEEEEVL, Genscript) were labelled with Alexa Fluor 488-C5-maleimide at 1:1 molar ratio in 50 mM Tris ...
-
bioRxiv - Immunology 2024Quote: ... Fine epitope mapping was performed by ordering synthetic peptides with N-terminal biotin residues (Genscript: 17-mer YHHHHHHDYDIPTTENL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Peptides with N terminal acetylation and C terminal amidation were purchased from Genscript (Rijswijk, Netherlands). Peptides were dissolved in DMSO ...
-
bioRxiv - Microbiology 2021Quote: ... N501Y.V1 (Variant 1) mutant Spike proteins of SARS-CoV-2 were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse Meis2 isoform D (4) (the tag was removed) and Lhx6 variant 1 (C-DYK) expressing vectors were purchased from Genscript, Dlx5 and Pbx1 coding sequences were amplified from mouse cDNA and cloned into pcDNA3.1 (Genscript) ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Cell Biology 2021Quote: ... (5) was synthesized by GenScript and subsequently subcloned into the respective restriction sites of pcDNA4/TO-CLC7-Y715C ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 5 peptides matching inoculum sequences for both the WT and SS14-DCKO strains (Table 3, labelled with a superscripted “1”) were produced by Genscript (Piscataway, NJ). Upon reception ...
-
bioRxiv - Genetics 2023Quote: ... every 1 μg RNA solution was ligated with 3 μl 25-μM poly(A)-ssRNA adaptor (pAGCUAAAAAAAAAAAAp, synthesized by GenScript Biotech Co.) at 16 °C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... V165A & R166A)50 and NL4.3(Δ: Δ(105 − 278)&Δ(301 − 332))44 in the HIV-1 proviral clone pNL4-3 were performed by GenScript. For use in electron microscopy ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies were dissolved in 5% BSA (Biofroxx, 4240GR005) and the dilutions were: Streptavidin-HRP (1:2000, GenScript, M00091), RL2 (1:1000 ...
-
bioRxiv - Bioengineering 2024Quote: ... Stiff elastic (50 kPa) NorHA hydrogel precursor solutions (5 wt% NorHA) containing 1 mM thiolated RGD peptide (GCGYGRGDSPG, Genscript) and dithiothreitol (DTT ...
-
bioRxiv - Cell Biology 2020Quote: Sequences of full length hsRIPK2 with an N-terminal 3x-Flag tag were synthesized by Genscript and cloned into doxycycline-inducible lentiviral expression vectors (pF_TRE3G_rtTAAd_puro (Takara Bio)) ...
-
bioRxiv - Biochemistry 2020Quote: ... archaeon HeR gene (GenBank ID: KYK26602.1) containing an N-terminal histidine-tag was chemically synthesized (GenScript) and subcloned into the pET21a (+)-vector ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Each 7-mer D-peptide with an N-terminal cysteine was synthesized by GenScript (Piscataway, NJ). Peptides were conjugated with IRDye 800CW maleimide (Li-Cor ...
-
bioRxiv - Immunology 2020Quote: ... The S1-N-terminal domain (S1-NTD, amino acids 16-318) was custom synthesized by GenScript. Each protein was expressed with an N-terminal His6-Tag to facilitate purification ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse α-DG lacking the N-terminal domain (H30 – A316) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the muscle-specific MCK promoter ...
-
bioRxiv - Biochemistry 2023Quote: N-terminally biotinylated synthetic MUC1 peptide with the sequence biotin-GGS-APDTRPAPG was ordered from Genscript. This was dissolved in PBS and printed on a planar streptavidin-coated SPR chip (P-Strep ...
-
bioRxiv - Cell Biology 2023Quote: ... The N-terminal 3xFlag tag was removed by incubation with the GST tagged Prescission Protease (GenScript) (final 0.01U/ul ...
-
bioRxiv - Microbiology 2023Quote: ... a custom-synthetized N-terminally biotinylated peptide comprising residues Met1 to Gln38 of LmdC (GenScript, USA) was immobilized on the biosensors ...
-
bioRxiv - Microbiology 2024Quote: ... The recN and recA genes were cloned into pK(N)T25 and pUT18(C) vectors (GenScript) to create N– and C-terminal fusions with T25 and T18 fragments (Supplementary Table S1).
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Neuroscience 2024Quote: ... and FAT-2 (Genscript) cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215 ...
-
TRANSITION OF PODOSOMES INTO ZIPPER-LIKE STRUCTURES IN MACROPHAGE-DERIVED MULTINUCLEATED GIANT CELLSbioRxiv - Cell Biology 2020Quote: ... IL-4 was from Genscript (Piscataway, NJ).