Labshake search
Citations for GenScript :
201 - 250 of 918 citations for Monoisononyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of ACE2 binding to SARS-CoV-2-RBD was performed on serum specimens using a commercially available SARS-CoV-2 sVNT Kit (L00847; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... 10-residue SARS-CoV-2 S2 peptide FKEELDKYFK (GenScript) was dissolved in 100% DMSO at 10 mg/mL and then diluted with PBS to 1 mg/mL ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 Nucleocapsid was purchased from Genscript (Z03480). SARS-CoV-1 spike (40634-V08B) ...
-
bioRxiv - Plant Biology 2021Quote: ... flg22 (2 µM; Genscript, Piscataway, Township, New Jersey, USA). All PAMPs were dissolved in 10 mM MgCl2 ...
-
bioRxiv - Microbiology 2022Quote: ... Following the injection of 2 units PreScission Protease (GenScript), the column was sealed and placed on a rotator at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: The anti-LmrC(2) antibody was generated by GenScript USA Inc ...
-
bioRxiv - Immunology 2021Quote: ... using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Immunology 2021Quote: ... using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Immunology 2023Quote: ... A SARS-Cov-2 neutralizing monoclonal antibody (GenScript #A02057) was used as a positive control at a starting concentration of 3.2 ng/µL ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 surrogate virus neutralization test (GenScript) was used to detect neutralizing antibodies targeting the viral spike (S ...
-
bioRxiv - Neuroscience 2024Quote: ... The mCherry WT- dynamin-2 was constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Plant Biology 2020Quote: ... either a 100 nM solution of flg22 immunogenic flagellin peptide (GenScript), or a 0.2% solution of chitin (method2 from [89]) ...
-
bioRxiv - Immunology 2021Quote: ... Plates were coated overnight with 100 ng/well of S1 (Genscript) in coating buffer (0.015M carbonate/bicarbonate buffer ...
-
bioRxiv - Immunology 2020Quote: ... with 100 μg soluble AdpgkMut (ASMTNMELM) or AH1 (SPSYVYHQF) peptide (GenScript) with 50 μg poly(I:C ...
-
bioRxiv - Immunology 2022Quote: ... were coated with 100 ng/well Delta-S1 protein (GenScript, China) or 250 ng/well purified Delta-S protein in PBS and incubated at 4 °C overnight ...
-
bioRxiv - Immunology 2020Quote: ... with complete RPMI (10%FBS, 1% Pen/Strep, 50uM b-mercaptoethanol) supplemented with 1ug/ml OVA Peptide (323-339) (Genscript, Cat. No. RP10610) (DAY0) ...
-
bioRxiv - Immunology 2022Quote: ... mice were intravenously injected with 0.1 mg (from a solution of 1mg/ml in PBS) of VP2121-130 (FHAGSLLVFM) or control E7 (RAHYNIVTF) peptide (GenScript, Piscataway, NJ, USA) into the tail vein.
-
bioRxiv - Microbiology 2023Quote: ... The solubilized membrane-fraction was loaded on a column containing 1 mL anti-DYKDDDDK (Flag) G1 affinity resin (50% suspension; GenScript, Piscataway, NJ, USA) pre-equilibrated with 3 bed volumes of TBS buffer ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Systems Biology 2020Quote: ... and 10ng/ml M-CSF (GenScript) for 7 days ...
-
bioRxiv - Bioengineering 2022Quote: ... 1ug/ml OVA257-264 peptide (GenScript) and 100IU/ml mIL-2 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 0.5 mg/mL FLAG peptide (GenScript), and 100 nM SE001 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 0.05 μg/ml FGF10 (GenScript). 0.1% ROCK inhibitor (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... binding of SARS-CoV2 and control IgG antibodies (at 1 µg/ml) to 15-mer S2 overlapping 5-amino acid peptides (n=52, GenScript Biotech, 500 ng/well) was tested using the same procedure as previously described (Wardemann ...
-
bioRxiv - Developmental Biology 2024Quote: ... A mixture of 100 ng/µL Cas9 protein (GenScript, New Jersey, USA) and 300 ng/µL gRNA for the injection into the eggs (per egg 2 nL was injected ...
-
bioRxiv - Immunology 2022Quote: ... DNA encoding SARS-CoV-2 HexaPro Spike was synthesized (Genscript) and transiently transfected in FreeStyle 293F cells (Thermo Fisher ...
-
bioRxiv - Physiology 2022Quote: ... The WT dynamin-2 mCherry plasmid were constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.2 mg/mL Protein C peptide (Genscript) and 5 mM EDTA ...
-
bioRxiv - Biophysics 2021Quote: ... and 0.2 mg/mL FLAG peptide (Genscript). Eluted A2AR-BRIL was concentrated with a 50 kDa MWCO spin concentrator (Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti c-Myc (Genscript, 0.5 μg/mL); Anti EIF3B (Santa Cruz ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.2 mg/ml protein C peptide (Genscript), and 30 µM ‘8090.
-
bioRxiv - Biochemistry 2022Quote: ... 0.2 mg/ml protein C peptide (Genscript), and 30 µM ‘8090 ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti c-Myc (Genscript, 0.3 μg/mL), Anti VCP (Santa Cruz ...
-
bioRxiv - Biochemistry 2021Quote: ... and 0.2 mg/mL FLAG peptide (Genscript). Eluted NK1R-miniGs/q70 was concentrated with a 50 kDa MWCO spin concentrator (Millipore ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 0.5 mg/mL Protein C peptide (GenScript), and 100 nM SE001 ...
-
bioRxiv - Biochemistry 2024Quote: ... and 500Lμg/mL synthesized Flag peptide (Genscript). The eluent was further purified by SEC using a Superose 6 increase 10/300 column (GE Healthcare ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3U/ml Epo (GenScript, #Z02975-50). In phase 2 (days 7-11) ...
-
bioRxiv - Molecular Biology 2020Quote: ... blocked with 5% milk and probed with C-Myc antibody (Genscript A00173-100), Rad53 antibody (Abcam ab104232) ...
-
bioRxiv - Microbiology 2021Quote: ... polyclonal anti-Bma-LAD-2 peptide antibodies were generated by Genscript. Rabbits were immunized with Bma-LAD-2 peptide sequences conjugated to keyhole limpet hemocyanin (KLH) ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding SARS-CoV-2 and other coronavirus S-2P (Genscript) were transiently transfected in FreeStyle 293-F cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Microbiology 2021Quote: ... Codon-optimized spike of SARS-CoV-2 was purchased from GenScript and subcloned to pcDNA3.1 ...
-
bioRxiv - Microbiology 2022Quote: ... An anti-SARS-2 nucleocapsid protein rabbit antiserum (generated by GenScript) was used at a 1:1000 dilution to detect specific anti–SARS-2 immunoreactivity using the Discovery ULTRA automated staining instrument (Roche Tissue Diagnostics ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein-crud (RP30020, GenScript Biotecn Corp). A ten amino acid overlapping peptide mixture pool was prepared ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 spike gene (Wuhan) was synthesized by Genscript for Dr ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 N and S1 proteins were obtained from Genscript and Sino Biological.
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Microbiology 2022Quote: ... and the protein was eluted with 10 mL of Buffer A supplemented with 0.2 mg/mL FLAG peptide (Genscript). The eluate was further purified by size exclusion chromatography (SEC ...
-
bioRxiv - Microbiology 2021Quote: ... The resin was washed with 60 mL of buffer A supplemented with 2 mM CaCl2 and the bound protein was eluted from the column with 10 mL of buffer A supplemented with 5 mM EDTA and 0.2 mg/mL FLAG peptide (Genscript).