Labshake search
Citations for GenScript :
201 - 250 of 420 citations for 4 4' Di N acetylamino diphenylsulfone d8 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... non-targeting sgRNA (TGCTTTACCGCGTTGGGTAA) or CLYBL targeting sgRNA (exon 2: CATAGAGCACTGCTCTCCGG; exon 3: AGACTTTGACCTGGGCACAA; exon 4: CCATTGCAGTCTCCACAAAG) were purchased from Genscript. Plasmids were transformed into OneShot™ E ...
-
bioRxiv - Biochemistry 2024Quote: The peptidase activity of the 20S CP was measured using a pair of substrates: the tripeptide benzyloxycarbonyl-Val-Leu-Arg-7-amino-4-methylcoumarin (Z-VLR-AMC, Genscript) and a 11-residue oligopeptide conjugated to 7-methoxycoumarin-4-acetic acid referred to as LF211 (7-methoxycoumarin4-acetic acid (MCA)-Lys-Lys-Val-Ala-Pro-Tyr-Pro-Met-Glu-(dinitrophenyl)diaminopropionyl-NH2 ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 spikes or their N-to-Q or N-to-A substituted variants were codon optimized and cloned into pcDNA3.1(+) plasmid (GenScript, Piscataway, NJ). The HIV gag/pol (pCMVΔR8.2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The lysate was heated at 95°C for 5 min and centrifuged at 10000 rpm/s for 2 min to remove the insoluble material prior to SDS-PAGE in a 4-20% gradient ExpressPlus™ PAGE Gels (Genscript) at constant 120 V for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Microbiology 2021Quote: ... heated for 8 minutes at 95°C and run on a precast 4-12% Bis-Tris PAGE gel (Genscript, Cat# M00654). Protein was transferred to a nitrocellulose (NC ...
-
bioRxiv - Cell Biology 2022Quote: ... 20-50 μg of protein lysate of each sample was loaded and separated on 4-12% Bis-Tris gels (Thermo Fisher or GenScript) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Blocking buffer was removed and replaced with 20 mL blocking buffer supplemented with 4 μL anti-HIS primary antibody (mAb, mouse, GenScript®) and the blot was incubated overnight at 4°C with agitation ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Lysates were mixed with Native-PAGE sample buffer 5X (Beyotime) and subjected to Native-PAGE using ExpressPlus™ 4-12% PAGE Gel (GenScript) and Tris-MOPS-SDS Running Buffer (GenScript) ...
-
bioRxiv - Microbiology 2021Quote: ... active protein fractions were further separated through sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; 4%–20% Bis-Tris Gel; GenScript, USA). Proteins in the gel slices were eluted in HEPES-K+ buffer (50 mM ...
-
bioRxiv - Microbiology 2021Quote: ... and 20 μg of protein lysates from each sample were denatured in 4X LDS sample buffer followed by separation on 4–12% gradient SDS PAGE polyacrylamide gel (Genscript, #M00653). Separated proteins on the polyacrylamide gel were transferred to a 0.2 μm PVDF membrane (Thermo Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to measure total protein content to enable equal loading of protein onto 4-12% precast mini polyacrylamide gels (SurePAGE™, GenScript). Proteins were transferred onto polyvinyl difluoride (PVDF ...
-
bioRxiv - Biochemistry 2024Quote: ... Cell debris were removed by centrifugation (10,000 x g for 10 min at 4°C) and the supernatant was incubated with 30 μL of protein A/G-coated magnetic beads (Genscript L00277) for 1 hour at 4 °C to remove nonspecifically bound proteins ...
-
bioRxiv - Molecular Biology 2022Quote: Equal sample concentrations (100 μg of total protein per well) were resolved in 4%–20% electrophoresis gradient gels (Genscript, Cat. M00656) and transferred onto polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 million cells/well were added into a 6-well plate and cultured with 2 mL RPMI-1640 medium/well (10 ng/mL IL-4, and 20 ng/mL mGM-CSF, GenScript, China) to obtain BMDCs at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2024Quote: ... An equivalent amount of total proteins was loaded in each lane and resolved on a 15% SDS-PAGE gel or 4-12% SurePAGE™ Bis-Tris gel (Genscript), transferred to nitrocellulose by electroblotting ...
-
CRISPR-based environmental biosurveillance assisted via artificial intelligence design of guide-RNAsbioRxiv - Molecular Biology 2024Quote: ... 4 µL of 5X optimized Cas13a reaction buffer (see Supplemental Table 6) or 2 µL 10X Cas13a reaction buffer (GenScript, #Z03486), 0.5 µL of Murine RNAse inhibitor (New England Biolabs - NEB ...
-
bioRxiv - Biophysics 2024Quote: Samples were quenched using 4X non-reducing Laemmli SDS sample buffer (TPpro, Taiwan) and then separated on 4-20% gradient SDS gels (GenScript, USA). Visualization of protein bands was carried out using an iBright FL1000 system (ThermoFisher ...
-
bioRxiv - Biochemistry 2020Quote: ... or N-terminal poly-histidine-tag (Genscript, codon-optimized) was expressed in E ...
-
bioRxiv - Microbiology 2023Quote: ... anti-CsoS2-N (1:10,000 dilution; synthesized by GenScript, NJ ...
-
bioRxiv - Biophysics 2023Quote: ... and N (GenBank: NC_045512.2) genes were synthesized by Genscript, Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... APEX2-HTT N-terminal fusions were generated by GenScript. HEK293 cells were transfected with APEX2-HTT-23Q and APEX2-HTT-82Q plasmids (using Lipofectamine 2000 ...
-
bioRxiv - Microbiology 2024Quote: ... and N-WASP CRIB mutant were generated by GenScript. pCS2+MT-hTOCA-1 WT ...
-
bioRxiv - Microbiology 2024Quote: ... and TmeB were cloned into pcDNA3.1+N-eGFP (Genscript) using KpnI or NotI/XbaI sites ...
-
bioRxiv - Pathology 2021Quote: ... the recombinant N protein was constructed by inserting the N gene of SARS-CoV-2 into the pGEX-6P vector (GenScript Japan, Tokyo, Japan). Next ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were heated for 10 min at 100°C and were then loaded on an SDS gradient gel (4–20% Precast Protein Improve Gels, Genscript Biotech Corporation). The gel was run for 120 min at 120 V ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the same amount of whole cell proteins extracted from a positive sample and a control sample were individually boiled with the gel-loading buffer (4×LDS, Genscript, Nanjing, China), and loaded onto a 4 – 12% gradient SDS-PAGE gel (Genscript ...
-
bioRxiv - Biochemistry 2024Quote: Codon optimized sequences of NAPstar3b and HyPer7 for expression in mammalian cells were commercially synthesized (Supplementary Table 4) (GenScript Biotech, Rijswijk, Netherlands) and delivered in pcDNA3.1(+ ...
-
bioRxiv - Developmental Biology 2024Quote: ... the membranes were incubated overnight at 4°C with anti-zebrafish Ybx1 primary antibody we prepared previously (1:2000) (GenScript, Nanjing, China) (26) ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were incubated with primary antibody for one hour (α-CLuc; Santa-Cruz Biotech) at room temperature or overnight at 4°C (α-His; GenScript), followed by washes with TBS-T ...
-
bioRxiv - Bioengineering 2023Quote: ... and KLF4 from a polycistronic transcript (TRE3-OSK) and second construct encoding rtTA version 4 driven by hEf1a promoter (hEf1a-rtTA4) were generated by Genscript (Piscataway, NJ) as reported previously (Lu et al. ...
-
bioRxiv - Cell Biology 2023Quote: Keratinocytes near confluency were extracted using 2X Laemmli Buffer.53 Samples were then loaded on a SurePAGE 4-12% Bis-Tris SDS-PAGE gel (Genscript, Piscataway, NJ) under denaturating conditions followed by protein transfer onto Immuno-Blot® PVDF Membranes (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2024Quote: Samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 4-12% Bis-Tris protein gel (GenScript Cat#M00653) with MES running buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... N-terminal CSF and “tethered” peptides were synthesized by GenScript. Chimeric G protein yeast strains were provided by GSK under material transfer agreement.
-
bioRxiv - Biochemistry 2020Quote: ... and a C-terminal TAMRA label (N-AAARKKRRQRRR-C, Genscript), and MerMade-synthesized unlabeled HIV-1 TAR ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding N-terminal domain proteins were obtained from GenScript. Plasmids were transiently co-transfected in FreeStyle 293-F cells using 293Fectin (ThermoFisher) ...
-
bioRxiv - Biochemistry 2024Quote: ... p41 with iRFP on N-terminal in pcDNA3.1(+) by Genscript U.S.A ...
-
bioRxiv - Microbiology 2024Quote: ... custom rabbit anti-JCV N (1:200; Genscript, Y743THG190-16), rabbit anti-Lrp1 (1:500 ...
-
bioRxiv - Microbiology 2024Quote: ... custom rabbit anti-JCV N (1:500; Genscript, Y743THG190-16), mouse anti-βIII-tubulin (1:500 ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were then incubated overnight at 4 °C in PBST with polyclonal rabbit antibodies raised against mcrA (1:10000 dilution) (GenScript, Piscataway, NJ, USA), washed four times for five minutes in PBST ...
-
bioRxiv - Biophysics 2024Quote: The S-S309 antigen-antibody antibody complexes were electrophoresed on the 4-12% SurePAGE™ Bis-Tris gel (Genscript Biotech Corporation, Jiangsu, China). The proteins were visualized by One-Step Blue Stain (Biotium ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were incubated overnight at 4°C with the following primary antibodies: rabbit polyclonal anti-AQP4 (1:4000, GenScript Biotech, Piscataway, NJ, USA), rabbit polyclonal anti-AQP4ex (1:2000 ...
-
bioRxiv - Microbiology 2024Quote: ... DEPQRETLKAIHYALN) and scrambled peptide (Scr; QEALKYNRAETPLDIH) were designed as described previously (4) and synthesized using solid phase Fmoc chemistry (Genscript, New Jersey, USA). The peptide ...
-
bioRxiv - Immunology 2024Quote: ... The binding of VHHs was next followed by a 30 min incubation at 4 °C with an anti-FLAG-iF647 antibody (A01811, Genscript, Piscataway, NJ, USA), diluted 1:500 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we transformed 4 μg of a dsDNA cassette carrying the full-length adk.d6 variant with 400 bp flanking genomic homology (constructed by GenScript USA Inc., Supplementary Table 4). Cells were grown in the presence of 200 μM bipA in 2×YT media throughout the entire procedure ...
-
bioRxiv - Neuroscience 2024Quote: ... A total of 20–50 μg of the protein lysate was loaded onto a polyacrylamide gel (SurePAGE™, Bis-Tris, 10×8, 4%–12%, GenScript, Piscataway, NJ, USA), and the separated proteins were transferred to a 0.45 µm polyvinylidene fluoride (PVDF ...
-
bioRxiv - Cancer Biology 2021Quote: ... that contains a N-terminal His TEV cleavage tag by Genscript. Protein expression was carried out in Escherichia coli C41(DE3) ...
-
bioRxiv - Biophysics 2020Quote: N-terminally formylated PSM peptides (> 95% purity) were purchased from GenScript Biotech ...
-
bioRxiv - Microbiology 2022Quote: ... M and N with respective promoters were synthesized commercially (GenScript, USA) and cloned in pBacPAK9 with restriction sites BamHI and EcoRI ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 N and S1 proteins were obtained from Genscript and Sino Biological.