Labshake search
Citations for GenScript :
201 - 250 of 466 citations for 2 3 Cyclohexenyl Ethyltrimethoxysilane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV-2 Spike protein (S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ) was added at concentrations ranging from 0.07 to 500 to nM ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were stimulated with synthetic SARS-CoV-2 S peptides pool (Genscript, Cat# RP30020) at the concentration of 2 μg/mL for 12 h and then incubated with 5 μg/mL Brefeldin A (MCE ...
-
bioRxiv - Biochemistry 2022Quote: ... YedK peptide consisting of the amino acids 2-16 (CGRFAQSQTREDYLA) was synthesized by Genscript. 50 nM 5’-FAM-labeled AP-DNA (FAM_U_20 ...
-
bioRxiv - Microbiology 2020Quote: ... (2) the mScarlet gene (amplified from a P. falciparum codon-adjusted synthetic sequence (Genscript) (Fig ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV and SARS-CoV-2 (GenBank accession number NC_045512.2) were synthesized by GenScript Corporation (GenScript ...
-
bioRxiv - Immunology 2022Quote: ... the standard curve was run using an IgG1 SARS-CoV-2 neutralizing antibody (GenScript) for full quantification ...
-
bioRxiv - Immunology 2021Quote: Competitive inhibition ELISA was performed using SARS-CoV-2 neutralization antibody detection kit (Genscript). The kit detects circulating neutralizing antibodies against SARS-CoV-2 that block the interaction between the receptor binding domains of the viral spike glycoprotein (RBD ...
-
bioRxiv - Molecular Biology 2021Quote: The SARS-CoV-2 surrogate virus neutralization test (sVNT) kit was obtained from GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: ... gene segment containing spike protein of SARS-CoV-2 wa s synthesized by GenScript Inc ...
-
bioRxiv - Immunology 2020Quote: ... human recombinant IL-2 (10 U/well) and with or without SIINFEKL peptide (Genscript) at 0.2ug/ml ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Microbiology 2024Quote: ... and synthetic fragments and genes encoding the fluorescent proteins from Genscript (Supplementary Table 2).
-
bioRxiv - Biochemistry 2023Quote: DNA encoding PEDV and SARS-CoV-2 nsps were codon optimized and synthesized (Genscript). PEDV protein sequences correspond to GenBank AKJ21892.1 ...
-
bioRxiv - Biochemistry 2022Quote: ... and were cultured in the presence of 10 ng/mL IL-2 (Genscript #Z00368), and the presence or absence of TNFα (100 ng/mL ...
-
bioRxiv - Microbiology 2024Quote: ... and SARS-CoV-2 D614G (GISAID Accession: EPI_ISL_5851484) were synthetized by GenScript (Piscataway, NJ) and cloned into pVRC8400 or pcDNA3.1(+ ...
-
bioRxiv - Immunology 2024Quote: ... Endotoxin levels of all antibodies were measured to be below 2 EU/mL (GenScript ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit).
-
bioRxiv - Plant Biology 2024Quote: ... were synthesised with Gateway-compatible attL1/2 sites and cloned into pUC57 by Genscript. 1-21aa-mCitrine includes a start codon with MtAPI bases 1528 to 1587 fused to the shortAPI-linker-mCitrine sequence ...
-
bioRxiv - Microbiology 2021Quote: ... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... with an empty vector (PC) or a vector against Bach1 with the following gRNA 5’ GCGGTTCCGAGCCCACCGCT 3’ (GenScript Biotech Corporation, USA) (BACH1 KO ...
-
bioRxiv - Cell Biology 2022Quote: ... and then incubated with HBSS containing or not 2 nM VEGF-A165 (Genscript, Piscataway, NJ) for 5 min at 37°C ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 mM CaCl2) using 10 U of Recombinant Bovine His6-Enterokinase (GenScript, Piscataway, NJ, USA) overnight at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... the membrane was incubated with 1:7000 polyclonal anti-Bma-LAD-2 peptide antibodies (Genscript) and 1:1000 rabbit anti-β actin antibodies (Abcam ...
-
bioRxiv - Microbiology 2020Quote: Human codon-optimized cDNA encoding SARS-CoV-2 S glycoprotein (NC_045512) was synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (GenScript, USA) in carbonate bicarbonate buffer (pH 9.6 ...
-
bioRxiv - Immunology 2022Quote: ... vaccines consisted of either SARS-CoV-2 Spike RBD WH-01 protein (GenScript; cat# Z03483) or SARS-CoV-2 WH-01 Spike protein (Acro Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid encoding for SARS-CoV-2 RBD was synthesized commercially (Genscript, Piscataway, NJ, USA). Recombinant RBD proteins were produced in transfected FreeStyle 293F cells (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: Neutralizing antibodies were measured using a SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript). Hamster sera was diluted from 1:20 to 1:500 incubated at a 1:1 ratio with HRP conjugated SARS-CoV-2 RBD protein for 30 min at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein B.1.1.529-Omicron (RP30121, GenScript Biotecn Corp, Piscataway, NJ) were used with the simultaneous control of the wild-type ...
-
bioRxiv - Neuroscience 2023Quote: ... The clarified supernatant was incubated overnight with 2 ml anti-DYKDDDDK G1 Affinity Resin (Genscript) at 4°C by batch binding ...
-
bioRxiv - Immunology 2023Quote: Neutralizing antibodies were assessed using the cPass SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript) according to manufacturer’s instructions with the following changes ...
-
bioRxiv - Bioengineering 2024Quote: ... 12 kPa (5% 40 kDa 8-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript), and 35 kPa (7% 20 kDa 8-arm PEG-NB ...
-
bioRxiv - Microbiology 2021Quote: ... pH 7.5) containing 3 % (w/v) skim milk powder and incubated with a rabbit anti-SLPMh 133-147 primary antibody (GenScript, Leiden, Netherlands), diluted 1:200 in TBS (10 mM TRIS ...
-
bioRxiv - Microbiology 2021Quote: ... and JPS-G3 VHHs [20] separated by 15-amino acid flexible glycine-serine linkers ((GGGGS)3) was synthesized (GenScript Biotech, Piscataway, NJ) and ligated into pET32b(+ ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... with a unique 5′fluorescent reporter dye (FAM) and 3 fluorescent quencher dye (TAMRA) were designed using mouse mitochondrial genome sequences and synthesized by Genscript (Piscataway, NJ). For absolute quantification using qPCR ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster U6:3 UTR that was amplified with primers 1045.C13 and 1045.C14 from a gene synthesized vector (GenScript, Piscataway, NJ) was cloned using EA cloning ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 5 peptides matching inoculum sequences for both the WT and SS14-DCKO strains (Table 3, labelled with a superscripted “1”) were produced by Genscript (Piscataway, NJ). Upon reception ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... sgRNA template sequences of the format: 5′-GGAGAACCACCTTGTTGG-(N)20-GTTTAAGAGCTAAGCTGGAAAC-3′ were synthesized in a pooled format on microarray surfaces (GenScript Biotech, Inc.). Oligo pools were PCR-amplified using Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... M2 ORF of Ca/04 and 83 nucleotides of the 3’ end of the PB1 gene (40 nucleotides encoding the C-terminus of PB1 ORF and 43 from the 3’UTR region) was synthesized by Genscript (Piscataway, NJ). The fragments were digested with BsmBI ...
-
bioRxiv - Cell Biology 2023Quote: ... Additional 5’ (GCTAGCA) and ‘3 sequences (CTTAAG) were added to the cDNA to carry out the cloning procedure (GenScript, Piscataway, NJ, USA). The inactive UGGT1 D1454A variant was generated with direct mutagenesis by GenScript ...
-
bioRxiv - Genetics 2023Quote: ... every 1 μg RNA solution was ligated with 3 μl 25-μM poly(A)-ssRNA adaptor (pAGCUAAAAAAAAAAAAp, synthesized by GenScript Biotech Co.) at 16 °C overnight ...
-
bioRxiv - Bioengineering 2023Quote: ... A DNA fragment for a floxed transcription stop transcription site (3 copies of SV40 late poly A sequence) followed by a H2B protein fused to mPlum was synthesized by Genscript (Piscataway, NJ) and inserted into pUC57-Kanamycin plasmid ...
-
bioRxiv - Microbiology 2024Quote: ... binding sites of bta-miRNA-16a within the 3’UTR of the bovine Furin were synthesized by a commercial provider (GenScript USA Inc). Briefly ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we constructed HDR plasmids with the egfp-chimeric hiphop-PBacDsRed cassette flanked with one kilobase homology arms 5’ and 3’ of their respective guide RNAs into pUC57-Kan (GenScript, Piscataway, NJ). The cassette consists of the 3xP3-DsRed visible marker (66 ...
-
bioRxiv - Microbiology 2024Quote: ... V165A & R166A)50 and NL4.3(Δ: Δ(105 − 278)&Δ(301 − 332))44 in the HIV-1 proviral clone pNL4-3 were performed by GenScript. For use in electron microscopy ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Immunology 2022Quote: ... The gene to express SARS-CoV-2 S2 PentaPro in prefusion conformation was synthetized by GenScript residues 686 to 1211 fused C-terminally to a foldon trimerization domain and His-tagged ...
-
bioRxiv - Immunology 2022Quote: ... vaccines consisted of 10 µg SARS-CoV-2 Spike RBD WH-01 protein (GenScript, cat# Z03483), combined with 1 nmol AMP-CpG-7909 (AMP-CpG ...
-
bioRxiv - Microbiology 2020Quote: ... 60 or 100 nM of his/FLAG-tagged SARS-CoV-2 spike protein (GenScript, Z03481-100) was added to each well ...
-
bioRxiv - Immunology 2021Quote: ... human recombinant IL-2 (10 U/well) and with or without NP311 or NP366 peptides (Genscript) at 0.2ug/ml ...