Labshake search
Citations for GenScript :
201 - 250 of 793 citations for 1R 2S 6R 7S 4 4 DIMETHYL 3 5 DIOXA 8 AZATRICYCLO 5.2.1.0 2 6 DECAN 9 ONE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: Supernatants and eluted samples were run on 4-12% SurePAGE™ Bis-Tris Gels (M00652, M00653, or M00654, GenScript), followed by wet transfer to Immobilon-P polyvinylidene difluoride (PVDF ...
-
bioRxiv - Neuroscience 2024Quote: ... Then the slices were incubated overnight at 4°C with rabbit polyclonal anti-AQP4 (GenScript Biotech, Piscataway, NJ, USA) diluted 1:2000 in the blocking buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... (NM_005855.4, H-pSL056), RAMP2 (NM_005854.3, H-pSL042) and RAMP3 (NM_005856.3, H-pSL043) were purchased from Genscript (Piscataway, NJ, USA). The DNA construct of the calcitonin receptor C-terminally fused with NanoLuc luciferase [22] (Nluc_FL_CTR (H-pSL054) ...
-
bioRxiv - Cell Biology 2024Quote: ... UK). AFF3ir-ORF2 (Cat. No. C0302HL300-4) and AFF3ir-ORF1 (Cat. No. C0302HL300) antibodies were from GenScript (NJ, USA). GAPDH (Cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Biochemistry 2024Quote: ... 3’ BamHI) SARS-Cov-2 N gene (Gene ID: 43740575) in pET-11a vector without any affinity tag (GenScript). pET-11a expression vector carrying SARS-Cov-2 N gene was transformed in BL21 (DE3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... membranes were exposed to ChromoSensorTM One-Solution (GenScript) for 3–5 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... Equal amounts of protein (nominally 50 μg) from each sample were separated on 4-20% gradient Bis-Tris SDS-PAGE gels (GenScript), and protein was then electroblotted onto low autofluorescence PVDF membrane (Bio-Rad) ...
-
bioRxiv - Immunology 2021Quote: Membrane proteins from OP-treated or untreated JEG-3 or purified FC-tagged full length or truncated domains of CRT were incubated with 20 μg of NCR-Myc fusion proteins at 4° C with rotary agitation for 16 h and then with 100 μl anti-Myc coupled magnetic beads (Genscript) at 4° C with rotary agitation for 4 h ...
-
bioRxiv - Biophysics 2020Quote: ... 10 nM NS2B-NS3pro was incubated with the substrate benzoyl-Nle-Lys-Arg-Arg-7-amino-4-methylcoumarin (Bz-nKRR-AMC) (Genscript) at concentrations varying from 2 to 200 µM ...
-
bioRxiv - Neuroscience 2021Quote: ... Monomeric αSyn and αSyn oligomers were then resolved by SDS-Page into a gradient 4-20% SDS-Page gel (GenScript) and transferred to polyvinylidenedifluoride (PVDF ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: Michaelis-Menten kinetics of pre-SplB mutants were measured with the peptide substrate Ac-WELQ-AMC (Ac: acetyl-; AMC: 7-Amino-4-methylcoumarin, stock concentration: 26 mM in DMSO, concentration range: 13-1161 μM, Genscript) at an enzyme concentration of 125 nM to 2.5 μM using a Tecan infinite 200Pro (excitation wavelength 339 nm ...
-
bioRxiv - Immunology 2022Quote: ... RNA-sequencing was applied to confirm the full-length JURV genome (10,993 bp) as previously described.4 Infectious JURV was recovered from a full-length cDNA clone (Genscript, USA) comprising genes encoding for the nucleoprotein (JURV-N) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The supernatant was collected by centrifugation at 120,000g for 60 min at 4°C and then incubated with anti-DYKDDDDK Magnetic Beads (Genscript, L00835) for 1 h at 4°C ...
-
The activator domain of bacterial collagenases drives collagen recognition, unwinding and processingbioRxiv - Biochemistry 2023Quote: The coding sequences of V-B from Scl2.28 incorporating the 4 mutated tripeptides and the coding sequence of the V domain from Scl2.3 were purchased from Genscript (Germany). The modified coding sequence of V-B was cloned into a modified pET15b vector ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse Meis2 isoform D (4) (the tag was removed) and Lhx6 variant 1 (C-DYK) expressing vectors were purchased from Genscript, Dlx5 and Pbx1 coding sequences were amplified from mouse cDNA and cloned into pcDNA3.1 (Genscript) ...
-
bioRxiv - Cell Biology 2023Quote: ... 15-30 μg protein were loaded and separated by SDS-PAGE in 4–12% SurePAGE 12-well pre-cast gels (Genscript). Proteins were transferred onto PVDF membranes using iBlot or iBlot2 system (Thermo) ...
-
bioRxiv - Immunology 2024Quote: ... T2A sequence and an anti-CD19 single-chain variable fragment (scFv) fused to 4-1BB and CD3ζ stimulatory endodomains (for TRAC-CAR19-KI) were subcloned into recombinant AAV6 plasmids (GenScript). DNA sequences were flanked with 400 base-pair homology arms immediately upstream and downstream of the TET2 gRNA or TRAC gRNA cut sites ...
-
bioRxiv - Microbiology 2023Quote: Pelleted virions were dissolved in SDS-PAGE sample buffer and subjected to electrophoresis on precast 4-20% gradient gels using Tris-MOPS running buffer (Genscript). Proteins were transferred to Protran nitrocellulose membranes (Perkin-Elmer ...
-
bioRxiv - Immunology 2024Quote: ... with pGS-CMAS-Neo plasmid with sgRNA targeting exon 4 of CMAS with CCATCCCAGTCTTGTCGACG gRNA from a U6 promoter and a neomycin-resistance marker (GenScript). Clonal A549 CMAS-deficient cell lines were established by limiting dilution after selection with 800 μg/mL G418 (GeneticinTM ...
-
bioRxiv - Immunology 2024Quote: ... Gametocyte extract and 230CMB 21 samples were mixed with 4× NuPAGE™ LDS sample buffer and heated for 10 minutes at 70°C before loading on a 4–20% Bis-Tris gel (GenScript). 20 ng 230CMB was loaded per well and the Precision Plus Dual Color protein marker (Bio-Rad ...
-
bioRxiv - Molecular Biology 2024Quote: ... [32] Protein purity was confirmed by sodium-dodecyl-sulfate polyacrylamide electrophoresis (SDS-PAGE) on 4-15% gradient gels (Genscript, USA) stained with 0.0025% w/v each of Coomassie® Brilliant Blue G-250 and R-250 in 10% v/v ethanol ...
-
bioRxiv - Biochemistry 2024Quote: The peptidase activity of the 20S CP was measured using a pair of substrates: the tripeptide benzyloxycarbonyl-Val-Leu-Arg-7-amino-4-methylcoumarin (Z-VLR-AMC, Genscript) and a 11-residue oligopeptide conjugated to 7-methoxycoumarin-4-acetic acid referred to as LF211 (7-methoxycoumarin4-acetic acid (MCA)-Lys-Lys-Val-Ala-Pro-Tyr-Pro-Met-Glu-(dinitrophenyl)diaminopropionyl-NH2 ...
-
bioRxiv - Genomics 2024Quote: ... 5% glycerol and 0.2% NP-40) and eluted with 2 mg/mL HA peptides (GenScript, no. RP11735). To prepare western blot sample from co-IP eluates ...
-
bioRxiv - Immunology 2024Quote: ... vaccines consisted of 5 µg SARS-CoV-2 Spike RBD WH-01 (RBD) protein (GenScript, cat# Z03483) or 5 µg ovalbumin (OVA ...
-
bioRxiv - Cancer Biology 2023Quote: ... with an empty vector (PC) or a vector against Bach1 with the following gRNA 5’ GCGGTTCCGAGCCCACCGCT 3’ (GenScript Biotech Corporation, USA) (BACH1 KO ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Bioengineering 2024Quote: ... Modified synthetic sgRNAs (2’-O-methyl-3’phosphorothioate linkage modifications in the first and last three nucleotides) were purchased from Genscript. sgRNA concentration was calculated using the full-length product reporting method ...
-
bioRxiv - Microbiology 2023Quote: ... or 9 ug/mL of full-length FimH protein (antigen for custom antibody production, Genscript) was used.
-
bioRxiv - Bioengineering 2023Quote: ... buffer at pH 9 was functionalized with a thiolated cell-adhesive RGD peptide (GenScript, GCGYGRGDSPG) via a Michael-type addition reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... 20-50 μg of protein lysate of each sample was loaded and separated on 4-12% Bis-Tris gels (Thermo Fisher or GenScript) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Blocking buffer was removed and replaced with 20 mL blocking buffer supplemented with 4 μL anti-HIS primary antibody (mAb, mouse, GenScript®) and the blot was incubated overnight at 4°C with agitation ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Lysates were mixed with Native-PAGE sample buffer 5X (Beyotime) and subjected to Native-PAGE using ExpressPlus™ 4-12% PAGE Gel (GenScript) and Tris-MOPS-SDS Running Buffer (GenScript) ...
-
bioRxiv - Microbiology 2021Quote: ... active protein fractions were further separated through sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; 4%–20% Bis-Tris Gel; GenScript, USA). Proteins in the gel slices were eluted in HEPES-K+ buffer (50 mM ...
-
bioRxiv - Microbiology 2021Quote: ... and 20 μg of protein lysates from each sample were denatured in 4X LDS sample buffer followed by separation on 4–12% gradient SDS PAGE polyacrylamide gel (Genscript, #M00653). Separated proteins on the polyacrylamide gel were transferred to a 0.2 μm PVDF membrane (Thermo Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to measure total protein content to enable equal loading of protein onto 4-12% precast mini polyacrylamide gels (SurePAGE™, GenScript). Proteins were transferred onto polyvinyl difluoride (PVDF ...
-
bioRxiv - Biochemistry 2024Quote: ... Cell debris were removed by centrifugation (10,000 x g for 10 min at 4°C) and the supernatant was incubated with 30 μL of protein A/G-coated magnetic beads (Genscript L00277) for 1 hour at 4 °C to remove nonspecifically bound proteins ...
-
bioRxiv - Molecular Biology 2022Quote: Equal sample concentrations (100 μg of total protein per well) were resolved in 4%–20% electrophoresis gradient gels (Genscript, Cat. M00656) and transferred onto polyvinylidene difluoride (PVDF ...
-
bioRxiv - Microbiology 2024Quote: ... An equivalent amount of total proteins was loaded in each lane and resolved on a 15% SDS-PAGE gel or 4-12% SurePAGE™ Bis-Tris gel (Genscript), transferred to nitrocellulose by electroblotting ...
-
bioRxiv - Biophysics 2024Quote: Samples were quenched using 4X non-reducing Laemmli SDS sample buffer (TPpro, Taiwan) and then separated on 4-20% gradient SDS gels (GenScript, USA). Visualization of protein bands was carried out using an iBright FL1000 system (ThermoFisher ...
-
bioRxiv - Biophysics 2024Quote: ... Amyloid beta peptide (1-8: DAEFRHDS) from GenScript was co-crystallized with MBP-TREM2 N79Q by mixing at an 18:1 molar ratio prior to crystallization ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We ordered 6 libraries from GenScript® ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant mouse interleukin-6 (Z02767, Genscript) was dissolved in PBS and injected IP at a dose of 200 mcg/kg ...
-
bioRxiv - Microbiology 2021Quote: ... pH 7.5) containing 3 % (w/v) skim milk powder and incubated with a rabbit anti-SLPMh 133-147 primary antibody (GenScript, Leiden, Netherlands), diluted 1:200 in TBS (10 mM TRIS ...
-
bioRxiv - Cell Biology 2023Quote: ... Additional 5’ (GCTAGCA) and ‘3 sequences (CTTAAG) were added to the cDNA to carry out the cloning procedure (GenScript, Piscataway, NJ, USA). The inactive UGGT1 D1454A variant was generated with direct mutagenesis by GenScript ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... sgRNA template sequences of the format: 5′-GGAGAACCACCTTGTTGG-(N)20-GTTTAAGAGCTAAGCTGGAAAC-3′ were synthesized in a pooled format on microarray surfaces (GenScript Biotech, Inc.). Oligo pools were PCR-amplified using Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...