Labshake search
Citations for GenScript :
201 - 250 of 1013 citations for 1 tert Butoxy 4 methyl 2 nitrobenzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... samples were boiled then run on Surepage 4-12% Bis-Tris gels (#M00653, GenScript). Samples were then transferred onto 0.45 um nitrocellulose membranes in Tris-Glycine transfer buffer (25 mM Tris ...
-
bioRxiv - Microbiology 2021Quote: ... polyclonal anti-Bma-LAD-2 peptide antibodies were generated by Genscript. Rabbits were immunized with Bma-LAD-2 peptide sequences conjugated to keyhole limpet hemocyanin (KLH) ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding SARS-CoV-2 and other coronavirus S-2P (Genscript) were transiently transfected in FreeStyle 293-F cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Microbiology 2021Quote: ... Codon-optimized spike of SARS-CoV-2 was purchased from GenScript and subcloned to pcDNA3.1 ...
-
bioRxiv - Immunology 2021Quote: ... SARS CoV-2 Nucleocapsid human chimeric mAb (GenScript, Cat # A02039-100), or in-house antibodies to ORF3a and ORF8 served as positive controls ...
-
bioRxiv - Microbiology 2022Quote: ... An anti-SARS-2 nucleocapsid protein rabbit antiserum (generated by GenScript) was used at a 1:1000 dilution to detect specific anti–SARS-2 immunoreactivity using the Discovery ULTRA automated staining instrument (Roche Tissue Diagnostics ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein-crud (RP30020, GenScript Biotecn Corp). A ten amino acid overlapping peptide mixture pool was prepared ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 spike gene (Wuhan) was synthesized by Genscript for Dr ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 N and S1 proteins were obtained from Genscript and Sino Biological.
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Microbiology 2024Quote: ... The 2-mer and 3-mer oligos were ordered from GenScript USA ...
-
bioRxiv - Biophysics 2024Quote: ... supplemented with DTT (2 mM) and TEV protease (cat. # Z03030, GenScript), and dialyzed against buffer C (50 mM K2HPO4 ...
-
bioRxiv - Biochemistry 2024Quote: ... and SARS-CoV-2 nsp gene sequences were codon optimized (Genscript). Sequences for Gammacoronavirus galli IBV/M41/Y28 proteins originate from the GenBank sequence QWC71293.1 ...
-
bioRxiv - Microbiology 2021Quote: ... Aliquots of 12 μl were resolved on precast ExpressPlus 4-12% gradient gel (GenScript #M41212). Proteins were electroblotted to nitrocellulose membrane ...
-
bioRxiv - Biochemistry 2021Quote: ... 15 μg total protein was loaded and resolved on Bis-Tris 4-12% gels (GenScript) and transferred to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids for alpha-actinin-4 FRET-based tension sensors were synthesized and sequenced by Genscript. Alpha-actinin-4 sstFRET408 was constructed by inserting the sstFRET module between 408aa and 409aa of human alpha-actinin-4 (XP_016882820.1) ...
-
bioRxiv - Plant Biology 2022Quote: ... samples were run on a 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and stained with Fast Silver Stain Kit (Beyotime ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli codon-optimized 10xHis- PPEP-4 (lacking the signal peptide) construct was ordered from GenScript. The pET-16b 10xHis-PPEP-4 plasmid was transformed to E ...
-
bioRxiv - Neuroscience 2023Quote: ... 10Lμg of tissue lysates were resolved on a 4–12% Bris-Tris gel (M00668, GenScript) and transferred onto a nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of protein lysates were loaded onto SurePAGE Bis-Tris 4-20% gels (Genscript) and transferred either to
-
bioRxiv - Immunology 2022Quote: ... The samples were then run on the Bolt 4–20% Bis-Tris Plus Gel (GenScript) and western blot was performed ...
-
bioRxiv - Genetics 2023Quote: ... The protein samples were separated by SDS-PAGE (4-12% Bis-Tris gels, Genscript, #M41210C) with MOPS buffer (Tris-MOPS-SDS Running Buffer ...
-
bioRxiv - Plant Biology 2023Quote: Protein samples were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) or 10% SDS-PAGE gels and electrophoresed at 150 V for 2 h ...
-
bioRxiv - Genomics 2023Quote: Cell lysates from HMLE shLuc and shM2 were separated by 4-20% SDS-PAGE (Genscript) and transferred to a PVDF membrane (10600023 GE) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total cellular proteins were separated in 4-12% YoungPAGE Bis-Tris gels (GenScript, Nanjing, China) or 10% gels using One-Step PAGE Gel Fast Preparation Kit (Vazyme) ...
-
bioRxiv - Microbiology 2024Quote: ... the enriched proteins were separated on a gradient gel (GenScript, 4–20% precast polyacrylamide gel) at 120V for 5∼10 min ...
-
bioRxiv - Biochemistry 2024Quote: Pull down samples were then run on a 4-12% Bis-Tris denaturing gel (GenScript), then analyzed by Western blotting ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant SARS-CoV-2-RBD (T80302) was obtained from Genscript (NanJing, China). Antagonist peptide 1 (SCSLFTCQNGIV ...
-
bioRxiv - Microbiology 2021Quote: ... the cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (Genscript, L00847), was used as directed to detect antibodies that bind competitively to the receptor binding domain (RBD ...
-
bioRxiv - Immunology 2022Quote: ... 2) TCRα-CD3δ crosslinking: rabbit anti-cMyc and mouse anti-FLAG (Genscript); 3 ...
-
bioRxiv - Biochemistry 2022Quote: The commercially available SARS-CoV-2 Neutralization Antibody Detection Kit (cPass, GenScript) was used to identify the presence of RBD neutralizing antibodies in the serum samples from mice immunized with r3CL-pro ...
-
bioRxiv - Immunology 2021Quote: A monoclonal anti-SARS-CoV-2 RBD capture antibody (GenScript, Cat# 5B7D7) was coated on Nunc Maxisorp ELISA plates (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... An anti-SARS-CoV-2 Spike monoclonal neutralizing antibody (GenScript, Cat# 6D11F2) was used as a positive control ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2-RBD-his protein was purchased from GenScript (GenScript, Nanjing), and GPC5-his protein was purchased from R&D (Minneapolis ...
-
bioRxiv - Immunology 2022Quote: ... A SARS-CoV-2 neutralizing monoclonal antibody (mAb; GenScript, Piscataway, NJ; #A02057), was used as a positive control at a known starting concentration of 3.2 ng/µL followed by serial 1:2 dilutions similarly to each sample and negative control ...
-
bioRxiv - Microbiology 2020Quote: ... and SARS-CoV-2 spike protein (ECD, His & Flag Tag) (GenScript Z03481). Proteins were biotinylated using EZ-Link™ Sulfo-NHS-Biotin ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Immunology 2021Quote: ... and B.1.617.2+ SARS-CoV-2 RBD construct were synthesized by GenScript into pCMVR with an N-terminal mu-phosphatase signal peptide ...
-
bioRxiv - Immunology 2022Quote: ... 2 µg/ml MHC-I binding SIINFEKL peptide (ovalbumin 257-264, GenScript), or 2 µg/ml ISQAVHAAHAEINEAGR MHC-II binding peptide (ovalbumin 323-339 ...
-
bioRxiv - Neuroscience 2023Quote: The riboprobes were synthetized from 2 clones that were purchased from Genscript or obtained by BBSRC ChickEST Database (Boardman et al. ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit (GenScript, L00847-A) was used according to the manufacturer’s instructions as follows ...
-
bioRxiv - Immunology 2024Quote: ... The SARS-CoV-2 Mac1 macrodomain was cloned into pcDNA3.1 by Genscript with both an N-terminal 3XFLAG tag and a C-terminal HiBiT tag as listed in Supplementary Table 5 ...
-
bioRxiv - Biophysics 2024Quote: The sequence expressing SARS-CoV-2 N protein was obtained from Genscript inside Pet-28 plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... Whole worm lysates were then separated on 4-12% polyacrylamide gradient gels (GenScript #M00652 and #M00654), transferred to nitrocellulose membranes ...
-
bioRxiv - Cell Biology 2021Quote: ... fap42 and fap246 strains were separated on a 4–12% gradient SDS-polyacrylamide gel (Genscript Biotech). After the dye front migrated on the gel for 3.0–3.5 cm ...
-
bioRxiv - Cell Biology 2020Quote: Proteins were separated by SDS-PAGE on 4%-20% MOPS-acrylamide gels (GenScript Express Plus, M42012) and electrophoretically transferred onto Immobilon PVDF membranes (Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... and loaded in each well of a 4-20% SurePAGE™ Bis-Tris gel (M00656, GenScript). Proteins were separated by SDS-PAGE and transferred to a nitrocellulose membrane (1620145 ...
-
bioRxiv - Cell Biology 2022Quote: ... P-factor (TYADFLRAYQSWNTFVNPDRPNL) and α-factor (WHWLQLKPGQPMY) (Custom Peptide Synthesis, 4 mg, ≥95% purity, GenScript Biotech) were dissolved in DMSO to a concentration of 10 mM ...