Labshake search
Citations for GenScript :
201 - 250 of 841 citations for 1 6 Chloropyridazin 3 yl piperidine 4 carboxamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... fap42 and fap246 strains were separated on a 4–12% gradient SDS-polyacrylamide gel (Genscript Biotech). After the dye front migrated on the gel for 3.0–3.5 cm ...
-
bioRxiv - Cell Biology 2020Quote: Proteins were separated by SDS-PAGE on 4%-20% MOPS-acrylamide gels (GenScript Express Plus, M42012) and electrophoretically transferred onto Immobilon PVDF membranes (Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... and loaded in each well of a 4-20% SurePAGE™ Bis-Tris gel (M00656, GenScript). Proteins were separated by SDS-PAGE and transferred to a nitrocellulose membrane (1620145 ...
-
bioRxiv - Cell Biology 2022Quote: ... P-factor (TYADFLRAYQSWNTFVNPDRPNL) and α-factor (WHWLQLKPGQPMY) (Custom Peptide Synthesis, 4 mg, ≥95% purity, GenScript Biotech) were dissolved in DMSO to a concentration of 10 mM ...
-
bioRxiv - Immunology 2020Quote: ... concentrated and evaluated by SDS-PAGE using 4 –12% Bis–Tris Novex gels (GenScript catalog #M00652) under reducing and non-reducing conditions followed by a Coomassie blue staining (Expedeon ...
-
bioRxiv - Neuroscience 2020Quote: ... and equal amounts of protein were separated on a 4-12% SDS-gel (Genscript SurePAGE™). Proteins were transferred onto a PVDF Immobilon-P (0.45 µm Millipore) ...
-
bioRxiv - Biochemistry 2021Quote: ... 15 μL of each sample was loaded in a 4-12% Bis-Tris SurePAGE gel (GenScript) using MOPS running buffer and then transferred onto a PVDF membrane (Millipore) ...
-
bioRxiv - Immunology 2020Quote: ... at 95°C for 5 min and then separated using ExpressPlus PAGE Gels 4-20% (GenScript). Proteins were transferred to a polyvinylidene fluoride (PVDF ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were run on 4-12% ExpressPlus PAGE gels with Tris-MOPS-SDS running buffer (GenScript). Transfer was carried out in the cold room overnight in Tris-glycine buffer (250 mM Tris ...
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... The samples were loaded onto three independent SurePAGE Bis-Tris 10x8 4-12% gels (Genscript M00652) and run at 150 V for approximately one hour ...
-
bioRxiv - Genetics 2023Quote: Proteins were separated by SDS-PAGE on 4%-20% MOPS-acrylamide gels (GenScript Express Plus, M42012) and electrophoretically transferred onto PVDF membranes ...
-
bioRxiv - Developmental Biology 2023Quote: Immunoblot was performed according to a standard procedure using 4%-20% gradient SDS polyacrylamide gels (Genscript). Cells were directly lysed in 4X Laemmli gel loading buffer (Boston BioProducts) ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins were separated by SDS-PAGE using 4%-20% MOPS-acrylamide gels (GenScript Express Plus M42012) and transferred electrophoretically onto Immobilon PVDF membrane (Merck) ...
-
bioRxiv - Molecular Biology 2024Quote: Proteins were electrophoresed in a 4-20% SurePAGE gel and Tris-MOPS-SDS running buffer (GenScript). Proteins were transferred to a nitrocellulose membrane in wet conditions (25 mM Tris base ...
-
bioRxiv - Neuroscience 2024Quote: ... 30-50 μg of protein were loaded on or ExpressPlus™ PAGE 4–20% gels (GenScript), in MOPS running buffer or 7.5% ...
-
bioRxiv - Cancer Biology 2024Quote: ... to denature protein and loaded onto 4-12% GenScript SurePAGE™ Precast Gels (GenScript cat# M00653). The electrophoresis was run in Tris-MOPS-SDS running buffer (GenScript cat# M00138 ...
-
bioRxiv - Cell Biology 2024Quote: ... equal amounts of proteins were loaded and separated on a 4-20% SDS–PAGE (GenScript, M42015C). The proteins were transferred to PVDF membrane (Cytiva ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Pathology 2022Quote: ... Jagged-1 peptide (1 uM, Genscript), Y-27632 (10 uM ...
-
bioRxiv - Neuroscience 2022Quote: ... ANS4-GFP and bEnd.3 cells were both treated with 100nM of 43gap 26 peptide (VCYDKSFPISHVR) (Genscript, catalogue # RP20274), every 8 hr for 24 hr ...
-
bioRxiv - Biochemistry 2023Quote: ... A backbone vector containing the 3’ and 5’ segments of the Kv1.2 gene (including the UTR regions) in pUC57-Kan was ordered from Genscript. The final constructs were assembled using golden-gate cloning(52) ...
-
bioRxiv - Cell Biology 2023Quote: The human Calpain 3 and 21 bp-deletion Calpain 3 mutant were synthesized and sub-cloned in the pcDNA3.1 vector containing a C-terminal FLAG tag by GenScript. Wild-type and deletion mutant plasmid constructs for Drosophila Calpain A and Calpain B were synthesized and sub-cloned in the pUASTattb vector to generate transgenic Drosophila lines from BestGene.
-
bioRxiv - Biochemistry 2024Quote: ... 3’ BamHI) SARS-Cov-2 N gene (Gene ID: 43740575) in pET-11a vector without any affinity tag (GenScript). pET-11a expression vector carrying SARS-Cov-2 N gene was transformed in BL21 (DE3 ...
-
bioRxiv - Microbiology 2022Quote: ... SDS-PAGE was performed using 30 μ l of sample with 4-20% Bis-Tris gels (Genscript) in Tris-MOPS-SDS running buffer (Genscript) ...
-
bioRxiv - Cell Biology 2020Quote: ... A total of 40 µg proteins were separated by 4-20% gradient SDS-PAGE gels (GenScript, M42015C) and transferred to PVDF membranes (Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were run on precast SurePAGE gels (Bis–Tris, 10×8, 4%– 12%, 15 wells; GenScript) and transferred to polyvinylidene difluoride membranes (Beyotime Biotechnology ...
-
bioRxiv - Microbiology 2023Quote: ... BA.2 and BA.4/5 lacking the C-terminal 19 codons (SΔ19) was synthesized by GenScript. The SΔ19 gene of BA.2.75 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and electrophoresed in 4-12% Express-Plus PAGE gels in Tris-MOPS (SDS) running buffer (GenScript #M00138). Proteins were transferred onto PVDF membranes ...
-
bioRxiv - Cancer Biology 2023Quote: Input and IP protein samples were separated on a 4-12% Bis-Tris protein gel (GenScript, M41215C) using Tris-MOPS running buffer and then transferred onto a PVDF membrane and blocked overnight in 3% BSA in PBST buffer (PBS + 0.1% Tween 20) ...
-
bioRxiv - Cell Biology 2024Quote: A total of about 75 ng of proteins were loaded on 4-20% acrylamide gels (GenScript, M00655) and run at 120 V for 90’ in commercial Tris-MOPS-SDS running buffer (GenScript ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Systems Biology 2021Quote: ... The +1 nucleotide was mutated to all other nucleotides (G, C or T) and these 3 mutant plasmids were synthesized into DNA oligos and cloned by Genscript.
-
bioRxiv - Biochemistry 2021Quote: ... The cell debris was removed by centrifuging at 16000 rpm for 30 min and the supernatant was loaded onto 3 mL of Ni-NTA resin (Genscript). A gravity flow Ni-NTA chromatography was performed ...
-
bioRxiv - Genetics 2022Quote: The HTP-3 antibody used in this study was generated from an identical C-terminal segment of the HTP-3 protein (synthesized by GenScript) as was used by (MacQueen et al ...
-
bioRxiv - Immunology 2022Quote: ... according to the manufacturer’s instructions and plated in 24 well tissue culture plates at 3×106/well in in the presence of OT-I peptide (GenScript) and the following cytokines ...
-
bioRxiv - Immunology 2020Quote: ... zooepidemicus lacking the N-terminal signal seqence was synthesized and cloned into pGEX-6P-3 expression vector using BamHI and SalI restriction sites (Genscript). E ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Developmental Biology 2023Quote: Pre-validated gRNA sequences targeting the exon 3 of BMP4 or BMP7 gene were obtained from genome-wide databases provided by GenScript (https://www.genscript.com/gRNA-database.html ...
-
bioRxiv - Neuroscience 2022Quote: ... A matching clone in which all TAG triplets in the 3’-UTR were mutated to TGA to disrupt the Musashi binding sites was created using gene synthesis (Genscript). Gibson assembly was used to reclone the cDNAs into pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and either amplified from a clinical isolate (FR-3 and Muc) and cloned into a modified pUC19 backbone (fragments A-D) or de novo synthesized (GenScript) and cloned into a pUC57 backbone (fragments A-C).
-
bioRxiv - Genomics 2022Quote: ... a 9 base pair(bp)’Spatial barcode A’,(3) a 12bp anchor sequence(/AmC6/CTACACGACGCTCTTCCGA-Spatial barcode A-ACTGGCCTGCGA) (Genscript). To enlarge the barcode pool ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Microbiology 2024Quote: ... plasmid pUC57-KRV-9000-11375 containing part of NS5 gene and the 3’ UTR of KRV (nt 9000-11375) was synthesized by GenScript.
-
bioRxiv - Molecular Biology 2024Quote: ... containing two copies of the 3’ untranslated region (UTR) of the HBB gene and a poly-A sequence of 96 adenines were purchased by Genscript. ABE-SpRY-OPT plasmid was created by inserting the 3’UTR+poly-A fragment in the pCMV-T7-SpRY-P2A-EGFP (RTW4830 ...
-
bioRxiv - Bioengineering 2024Quote: ... Modified synthetic sgRNAs (2’-O-methyl-3’phosphorothioate linkage modifications in the first and last three nucleotides) were purchased from Genscript. sgRNA concentration was calculated using the full-length product reporting method ...
-
bioRxiv - Bioengineering 2024Quote: ... NorHA-CDHA hydrogels (3 wt% NorHA-CDHA) were fabricated by first mixing CDHA with a thiolated adamantane peptide (GCKKK-adamantane, Genscript) (1.2:1 molar ratio of Ad:CD ...