Labshake search
Citations for GenScript :
151 - 200 of 1345 citations for Synaptic Ras GTPase Activating Protein 1 Syngap1 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... the membrane was incubated with 1:7000 polyclonal anti-Bma-LAD-2 peptide antibodies (Genscript) and 1:1000 rabbit anti-β actin antibodies (Abcam ...
-
β-amyloid−driven synaptic depression requires PDZ protein interaction at AMPA-receptor subunit GluA3bioRxiv - Neuroscience 2021Quote: ... The following antibodies were used: anti-GluA2/3 (1:2000; CQNFATYKEGYNVYGIESVKI, custom made at Genscript) (Chen et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... The following antibodies were used in this study: anti-myc (1:1000 Genscript A00173-100), anti-Rad53 (1:1000 Abcam ab104232) ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit polyclonal short XIRP2 antibody (custom generated against the immunizing peptide NSKRQDNDLRKWGD, Genscript, 1:100), mouse monoclonal IgG1 γ-actin antibody (1-24 ...
-
bioRxiv - Microbiology 2023Quote: ... was detected by HRP-conjugated rabbit anti-camelid VHH antibodies (Genscript, A01861-200, 1/5000) or a mouse anti-HA antibody (BioLegend 901501 ...
-
bioRxiv - Cell Biology 2022Quote: ... samples were incubated with rabbit streptavidin antibody for 1 h (Genscript, A00621, 0.1 mg/mL). IgG and anti-streptavidin treated PS DAAM-particles were stained with donkey anti-rabbit-Alexa Fluor-647 antibodies (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... then incubated with 1:1000 dilution of custom rabbit anti-IPD3 polyclonal antibody (Genscript, China) followed by 1:2,500 donkey anti-rabbit AlexaFluor 488- conjugated secondary antibodies (Thermo Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies for assay of transfected cells were goat polyclonal anti-HA (1:500, GenScript), and mouse monoclonal anti-FLAG (1:500 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The transthyretin from the extractions was observed by using anti-transthyretin antibody (1:1000, Genscript) and anti-rabbit secondary antibody (1:1,000 ...
-
bioRxiv - Plant Biology 2023Quote: Protein samples were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) or 10% SDS-PAGE gels and electrophoresed at 150 V for 2 h ...
-
bioRxiv - Microbiology 2024Quote: ... The GST-tagged proteins were purified using a GST Fusion Protein Purification Kit (GenScript, L00207), whereas the His-tagged proteins were purified using Ni-NTA affinity chromatography media (GenScript ...
-
bioRxiv - Molecular Biology 2021Quote: ... Expression of METTL8 in stably-infected cell lines were characterized by immunoblotting with the anti-Strep antibody (THETM NWSHPQFEK antibody, Genscript, cat. No. A01732, 1:1000 dilution). Transient transfections of TWIN-Strep and FLAG-tagged proteins were also loaded onto BOLT 4–12% Bis-Tris gels ...
-
bioRxiv - Biophysics 2021Quote: ... CCKAR–G protein complexes were assembled at room temperature (RT) for 1 h by the addition of 10 μM CCK-8 (GenScript) and 25 mU/mL apyrase ...
-
bioRxiv - Biophysics 2020Quote: ... Recombinant nucleocapsid protein of SARS-CoV-2 (Catalog No: Z03488- 1) and SRPK1 kinase (Catalog No: PV4215) were purchased from GenScript andThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... CAR T cells were evaluated for CAR expression on the surface by flow cytometry with protein L (1:100; M00097, Genscript) as previously described(47) ...
-
bioRxiv - Immunology 2022Quote: ... for 30 minutes before adding 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) or infected using Heat-inactivated SARS-CoV-2 (VR-1986HK ...
-
bioRxiv - Immunology 2020Quote: ... 1mL of day 56 serum was diluted to 10 mL with PBS and incubated with 1 mL of 3x PBS washed protein A beads (GenScript) with agitation overnight at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... for >1 hour at ambient temperature then incubated with *** μg / protein gel of MonoRab anti-his tag C-term (Genscript) in Intercept T20 (PBS ...
-
bioRxiv - Immunology 2020Quote: ... Cells were cultured at 5e5 cells/well with two peptide pools representing the full-length S protein at 1 μg/ml (Genscript) overnight in order to stimulate the cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... and AALA mutant were produced as GST-fused proteins by cloning the encoding ORF sequences into the pGEX-6P-1 plasmid (GenScript).
-
bioRxiv - Immunology 2022Quote: ... for 30 minutes before being exposed with 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) at different times (5 ...
-
bioRxiv - Cell Biology 2022Quote: ... We used the following primary antibodies diluted in TNT buffer: anti-beta actin (1:1000, GenScript), anti-Lamin B1 (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-CCHa1 (Our lab raised antibodies against the peptide QIDADNENYSGYELT 68, Genscript, 1:50 dilution). Secondary antibodies used ...
-
bioRxiv - Microbiology 2024Quote: ... followed by primary staining of cells with rabbit anti-N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Microbiology 2024Quote: ... Membrane was blotted with anti-ChmA (dilution = 1:500; custom polyclonal rabbit antibody generated by GenScript), anti-PicA (dilution = 1:1,000 ...
-
bioRxiv - Genomics 2022Quote: ... Anti-Sloth1 and Anti-Sloth2 antibodies (1:1000) were raised in rabbits (Genscript, PolyExpress Silver Package).
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein ACE2-Fc (Genscript) at 5 μg/mL buffered in PBST (PBS with 0.02% Tween 20 ...
-
bioRxiv - Systems Biology 2021Quote: ... quadricauda predicted PGS protein (Genscript, www.genescript.com), and anti-Rubisco goat antiserum (diluted 1:3000 ...
-
bioRxiv - Biochemistry 2022Quote: ... And then Protein A beads (GenScript) were used to separate Fab fragments ...
-
bioRxiv - Immunology 2022Quote: ... and recombinant nucleocapsid protein (GenScript Z03488). The next day ...
-
bioRxiv - Immunology 2020Quote: ... and recombinant nucleocapsid protein (GenScript Z03488). The following day ...
-
bioRxiv - Immunology 2021Quote: ... and AmMag Protein A beads (Genscript) or loaded on a protein A (Cytiva ...
-
bioRxiv - Synthetic Biology 2022Quote: ... a multi-tag protein standard (Genscript) was serially diluted in 1xTBS with 0.5% Tween-20 buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein G coated MagBeads (Genscript #L00274) were equilibrated with Binding/Wash Buffer (20mM Na2HPO4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Protein G-Agarose beads (Genscript), Polyetheleneimine reagent (Polysciences ...
-
bioRxiv - Biochemistry 2023Quote: ... PAGE-MASTER Protein Standard Plus (GenScript) was used for the identification of target proteins.
-
bioRxiv - Immunology 2024Quote: ... Protein A Magnetic beads (GenScript, L00695) were added and incubated at room temperature for 2 hours ...
-
bioRxiv - Genetics 2024Quote: ΦC31 protein was subcontracted from GenScript (see the protein amino acid sequence in Supplementary Note 9) ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein of the extracellular domain of human ACE2 (aa 1-740) fused to Fc (ACE2-Fc, Genscript, Nanjing, China) was coated on 96-well microtiter plate (50 ng/well ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rosetta synaptobrevin a codon-optimised nucleotide sequence encoding the soluble portion of the protein [Syb (1-75)] was prepared by gene synthesis (Genscript, USA): GAGGCGAACCGTACCGGTGACTACCGTCTGCAGGAAGCGCAGCGTCAAGTGGGCGAAGTT CAAAACGTGATGCGTGATAACCTGACCAAGGTTATCGAGCGTGGTGAAAAACTGGACGATC TGGACGCGAAGGCGGAAGATCTGGAGGCGGAGGGTCAGCGTTTCCAAAACCGTGCGGGCC GTCTGCGTCGTCAGATGTGGTGGCAAAACAAACGTAACCAGTAA
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Cell Biology 2020Quote: ... and for generation of EGFP-C2-Arp3B plasmid, the mRNA transcript variant 1 encoding murine actin-related protein 3B (Actr3b) (Jay et al., 2000) was synthesized (GenScript Biotech) and cloned into pEGFP-C2 vector (Clontech).
-
bioRxiv - Biophysics 2024Quote: ... a pGEX-4T-1 vector coding for SH downstream of a GST carrier protein and a thrombin cleavage site was acquired from GenScript (US). The plasmid was transformed into competent E ...
-
bioRxiv - Immunology 2021Quote: Biotinylated SARS-CoV-2 S1 protein and biotinylated SARS-CoV-2 N protein were purchased from GenScript. The biotinylated proteins were combined with different streptavidin (SA ...
-
bioRxiv - Biochemistry 2023Quote: ... or proteins were transferred to PVDF membranes using an eBlot L1 protein transfer system (GenScript, Piscataway, NJ) and used for immunoblotting.
-
bioRxiv - Microbiology 2023Quote: ... The soluble protein fraction of cells expressing GST-tagged proteins was incubated with glutathione resin (GenScript; L00206) at 4°C for 1 h with constant rotation (10 rpm) ...
-
bioRxiv - Microbiology 2023Quote: ... cell-based expression system and RBD proteins were purified using Protein A affinity resin (Genscript Cat#: L00210). Protein purities were assessed by SDS-PAGE ...
-
bioRxiv - Cancer Biology 2023Quote: Input and IP protein samples were separated on a 4-12% Bis-Tris protein gel (GenScript, M41215C) using Tris-MOPS running buffer and then transferred onto a PVDF membrane and blocked overnight in 3% BSA in PBST buffer (PBS + 0.1% Tween 20) ...
-
bioRxiv - Immunology 2022Quote: ... the following pairs of primary antibodies were used: 1) TCRα-TCRβ crosslinking: rabbit anti-c-Myc (Genscript) and mouse anti-V5 (Genscript) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sections were incubated with 1 µg/ml of a custom-made MMP13 rabbit polyclonal primary antibody (GenScript, Piscataway ...