Labshake search
Citations for GenScript :
151 - 200 of 586 citations for Streptavidin ZAP Antibody Kit rat since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... MonoRabTM HRP Rabbit anti-Camelid VHH antibody (GenScript #A01861) was used to detect vhhGFP fusion proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... A custom RHINO polyclonal antibody was outsourced from GenScript using the recombinant protein described in the “Protein purification section” with 6xHIS tag retained and produced in rabbit (GenScript ...
-
bioRxiv - Plant Biology 2023Quote: Rabbit polyclonal antibodies were obtained from GenScript (NJ, USA). Epitopes were chosen based on the manufacturer’s prediction algorithm results in regions that were covered by the protein sequencing ...
-
bioRxiv - Biochemistry 2022Quote: ... Antibodies were custom-made by GenScript (New Jersey, USA), using the sequences provided in the Supplementary source data.
-
bioRxiv - Microbiology 2023Quote: ... rabbit immunization and antibody purification were conducted by Genscript Co ...
-
bioRxiv - Immunology 2023Quote: ... A SARS-Cov-2 neutralizing monoclonal antibody (GenScript #A02057) was used as a positive control at a starting concentration of 3.2 ng/µL ...
-
bioRxiv - Immunology 2023Quote: ... with MonoRab™ Rabbit Anti-Camelid VHH Antibody (GenScript) diluted 1:250 in coating buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-FLAG antibody conjugated to iFluor 488 (GenScript A01809) at 1:2,000 dilution ...
-
bioRxiv - Developmental Biology 2023Quote: The guinea pig Zfh1 antibody was generated by GenScript. Recombinant antigen consisting of amino acids 648-775 of Zfh1 isoform PB was produced with an N-terminal His-tag used for purification ...
-
bioRxiv - Biochemistry 2024Quote: ... anti-Strep-tag antibody (Genscript #A01732, ; 1:2,000 dilution), anti-FLAG-tag antibody (Sigma #F1804 ...
-
bioRxiv - Microbiology 2024Quote: ... and incubated with a α-HIS antibody (Genscript A00186), followed by HRP-conjugated α-mouse antibody (Abclonal AS003) ...
-
bioRxiv - Microbiology 2024Quote: ... A custom primary antibody for Imp1 (α-Imp1, Genscript), a commercial primary FLAG antibody (α-FLAG ...
-
bioRxiv - Genomics 2024Quote: ... The polyclonal antibody was purified by affinity column (GenScript). No cross reactivity against the host cell lysates was seen by western blots (Supplementary figure 13B) ...
-
bioRxiv - Microbiology 2022Quote: ... Heterologous expression was detected by electroblotting SDS-PAGE Tris-glycine gels onto nitrocellulose membranes and immunostaining with primary rabbit anti-His-tag antibody and secondary goat anti-rabbit IgG phosphatase alkaline conjugated antibody (GenScript, Piscataway, NJ, USA) (Suppl ...
-
bioRxiv - Cell Biology 2023Quote: ... The membrane sections were then incubated overnight at 4°C with the corresponding antibody: anti-ChmA (dilution = 1:500; custom GenScript polyclonal rabbit antibody), HRP-conjugated mouse anti-RpoB (dilution = 1:5,000 ...
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Biochemistry 2023Quote: ... the expression levels of each mutant series and their wild-type version were normalized for comparison purposes by quantitation via western blots against the 6xHis tags present at the C-termini of all constructs (Antibody: anti-His-Tag Antibody coupled with iFlour 488, Genscript, A01800, 1:500 dilution). Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Developmental Biology 2020Quote: ... custom made rabbit anti-chick MMP13 antibody (1μg/ml, Genscript), rabbit anti-CXCL14 (0.2 μg/ml ...
-
bioRxiv - Immunology 2022Quote: ... Horseradish peroxidase labeled mouse anti-His tag antibody (GenScript: A00186) was added for 30 minutes at 1:1000 dilution ...
-
bioRxiv - Biochemistry 2022Quote: ... 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984), 1:1000 anti-HA-Tag (C29F4 ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-mouse ZIP14 antibody was custom made by Genscript. Antibodies for GAPDH and actin were obtained from Cell Signalling.
-
bioRxiv - Microbiology 2021Quote: ... Polyclonal antibodies against OVA or SV40 were obtained from GenScript (GenScript ...
-
bioRxiv - Microbiology 2022Quote: ... in-house custom rabbit anti-RVFV nucleoprotein polyclonal antibody (Genscript) and anti-pan cytokeratin typeI/II anti-cytokeratin polyclonal antibody (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... labeling with 1:200 biotinylated anti-Strep tag antibody (GenScript) was followed by 1:500 BrilliantViolet 421 conjugated with Streptavidin (Biolegend) ...
-
bioRxiv - Microbiology 2022Quote: ... Mouse Anti-Rabbit IgG Fr secondary antibody (GenScript, Piscataway, NJ) 1:30,000 was used for assays of these rabbit-derived samples ...
-
bioRxiv - Microbiology 2021Quote: ... for SyNOS and a specific OtNOS antibody generated by GenScript Company.
-
bioRxiv - Plant Biology 2019Quote: ... and incubated with anti-c-Myc primary antibody solution (GenScript, 1 ...
-
bioRxiv - Microbiology 2019Quote: Peptide antibodies to the six TIPs were generated by GenScript using their standardized work flow ...
-
bioRxiv - Neuroscience 2021Quote: We used the following primary antibodies: NEEP21/NSG1 (Genscript A01442), FAM21 (Millipore ABT79) ...
-
Metal transporter SLC39A14/ZIP14 modulates regulation between the gut microbiome and host metabolismbioRxiv - Physiology 2021Quote: ... Rabbit anti-mouse ZIP14 antibody was custom made by Genscript. Antibodies for ZIP4 ...
-
bioRxiv - Microbiology 2020Quote: ... Rabbit anti-PknG antibody was produced and purified by GenScript Biotechnology with the recombinant GST-tagged PknG protein as immunogen (1/10000 for immunoblotting ...
-
bioRxiv - Microbiology 2020Quote: ... A human chimeric anti-S1 antibody (Genscript; 1:200 dilution) followed by an Alexa647-conjugated goat anti-human IgG (Jackson Laboratories ...
-
bioRxiv - Microbiology 2020Quote: A custom polyclonal anti-KH antibody was generated by GenScript, using their 49-day antibody generation protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and polyclonal αcGAS antibodies were purified by antigen affinity (GenScript). Serum was used at 1:30,000 for cGAS detection ...
-
bioRxiv - Molecular Biology 2023Quote: The polyclonal primary antibody anti-Orco was purchased from Genscript and designed against the peptide sequence SSIPVEIPRLPIKSFYPW in the second extracellular loop (ECL2) ...
-
bioRxiv - Biophysics 2023Quote: ... The His-Tag antibody (Cat# A00186S, GenScript, New Jersey, US) for 2h at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... or anti-HA antibody conjugated to iFluor 647 (GenScript A01808) at 1:1,000 dilution overnight at 4 °C with gentle rocking ...
-
bioRxiv - Biophysics 2023Quote: ... followed by 10 nM biotinylated antibody (mouse anti-FLAG, GenScript). Chambers were flushed to remove reagents ...
-
bioRxiv - Immunology 2023Quote: ... Antibodies were purified with Protein A magnetic beads (GenScript, L00273). Expression vectors for CoV-2196 ...
-
bioRxiv - Cell Biology 2023Quote: ... or anti-HA antibody conjugated to iFluor 647 (GenScript A01808) at 1:1,000 were used ...
-
bioRxiv - Immunology 2023Quote: Antibody heavy and light chain genes were synthesized by GenScript, separately inserted into vector plasmids (pCMV3-CH ...
-
bioRxiv - Evolutionary Biology 2024Quote: A custom anti-VGLL3 polyclonal antibody was procured from Genscript with delivery in January 2020 as follows ...
-
CRISPR-Cas9 Engineered Extracellular Vesicles for the Treatment of Dominant Progressive Hearing LossbioRxiv - Bioengineering 2023Quote: ... and anti-Cas9 antibody (Clone 4A1) were purchased from Genscript. All DNA oligos were purchased from Integrated DNA Technologies ...
-
bioRxiv - Developmental Biology 2023Quote: Anti-Miranda polyclonal antibody was generated by Genscript (https://www.genscript.com/). The epitope used for immunization is ...
-
bioRxiv - Evolutionary Biology 2024Quote: The rabbit antibody for Shavenbaby (Svb) was produced by GenScript against the following amino acid sequence:
-
bioRxiv - Immunology 2023Quote: ... THETM V5 Tag antibody (both at 1:5000 dilution, GenScript), and CLIPA8 primary antibody (1:5000 dilution ...
-
bioRxiv - Molecular Biology 2021Quote: ... Expression of METTL8 in stably-infected cell lines were characterized by immunoblotting with the anti-Strep antibody (THETM NWSHPQFEK antibody, Genscript, cat. No. A01732, 1:1000 dilution). Transient transfections of TWIN-Strep and FLAG-tagged proteins were also loaded onto BOLT 4–12% Bis-Tris gels ...
-
bioRxiv - Genomics 2023Quote: ... with CloneEZ PCR Cloning Kit (GenScript #L00339). The pLenti-GIII-EF1α-CBX3-Flag-HA ...