Labshake search
Citations for GenScript :
151 - 200 of 477 citations for 6 2 Ethoxyphenyl 6 oxohexanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of pseudovirus infection of cells containing SARS-CoV-2 receptors was performed on serum specimens using two commercially available SARS-CoV-2 LVV-PsN Kit (SC2087A; SC2087L; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of ACE2 binding to SARS-CoV-2-RBD was performed on serum specimens using a commercially available SARS-CoV-2 sVNT Kit (L00847; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... 10-residue SARS-CoV-2 S2 peptide FKEELDKYFK (GenScript) was dissolved in 100% DMSO at 10 mg/mL and then diluted with PBS to 1 mg/mL ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 Nucleocapsid was purchased from Genscript (Z03480). SARS-CoV-1 spike (40634-V08B) ...
-
bioRxiv - Plant Biology 2021Quote: ... flg22 (2 µM; Genscript, Piscataway, Township, New Jersey, USA). All PAMPs were dissolved in 10 mM MgCl2 ...
-
bioRxiv - Microbiology 2022Quote: ... Following the injection of 2 units PreScission Protease (GenScript), the column was sealed and placed on a rotator at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: The anti-LmrC(2) antibody was generated by GenScript USA Inc ...
-
bioRxiv - Immunology 2021Quote: ... using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Immunology 2021Quote: ... using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Neuroscience 2024Quote: ... The mCherry WT- dynamin-2 was constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 surrogate virus neutralization test (GenScript) was used to detect neutralizing antibodies targeting the viral spike (S ...
-
bioRxiv - Immunology 2023Quote: ... 2 µg/mL biotin conjugated Env peptides (GenScript, customized) were added to plates and incubated for 1 hour at RT ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Microbiology 2021Quote: ... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lamin-C was overproduced and purified from codon-optimized Lamin-C (amino acid residues 1-152) engineered into pRSF-Duet plasmid (Genscript Inc.). The construct carries a tandem N-terminal Strep-tag ...
-
bioRxiv - Biochemistry 2022Quote: Codon-optimized gene corresponding to 5 to 897 amino acids of KFDV NS5 with an N-terminal Hexa-histidine tag was synthesized (Genscript USA) and sub-cloned into pET-28a (+ ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and 2 mL Protein A slurry (1 mL resin, GenScript) was deposited in the columns ...
-
bioRxiv - Immunology 2022Quote: ... DNA encoding SARS-CoV-2 HexaPro Spike was synthesized (Genscript) and transiently transfected in FreeStyle 293F cells (Thermo Fisher ...
-
bioRxiv - Immunology 2020Quote: ... and 0.6 μg/mL SARS-CoV-2 S-ECD (GenScript). After washes with PBST (SMART-Lifesciences) ...
-
bioRxiv - Physiology 2022Quote: ... The WT dynamin-2 mCherry plasmid were constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Immunology 2023Quote: ... plus 10 ng/mL of mouse IL-2 (Z02764, Genscript) in 2 mL complete RPMI1640 medium for 72 h.
-
bioRxiv - Cell Biology 2020Quote: ... Trp68 rabbit polyclonal antibodies were custom generated and affinity purified against the TDP-43 amino acid sequence 65DAGWGNL71 by GenScript (Piscataway, NJ).
-
bioRxiv - Molecular Biology 2021Quote: ... elephas VTG amino acid sequence deduced in silico (Fig. 1A) was used to create two synthetic peptides (Fig 1B) (Genscript USA Inc.) to be employed for the production of specific anti-VTG antibodies (Twin Helix ...
-
bioRxiv - Microbiology 2021Quote: ... and JPS-G3 VHHs [20] separated by 15-amino acid flexible glycine-serine linkers ((GGGGS)3) was synthesized (GenScript Biotech, Piscataway, NJ) and ligated into pET32b(+ ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by 10 amino acid sequences covering the four reported binding sites on the clathrin terminal domain (see Fig. 7A) were synthesized by GenScript (Piscataway, NJ) with > 95% purity ...
-
bioRxiv - Immunology 2021Quote: ... resuspended at a density of 15 million/mL in complete RPMI and 100 μL of cell suspension containing 1.5 million cells was added to each well of a 96-well round-bottomed tissue culture plate and stimulated ex vivo with a peptide pool consisting of 15mer peptides overlapping by 11 amino acids spanning the S protein (GenScript, Piscataway, NJ), at a concentration of 1.2 μg/mL of each peptide in the presence of 1 μg/mL anti-CD28 ...
-
bioRxiv - Biochemistry 2023Quote: ... and Ub-MCQ (Ub variant with an additional amino acid Cys between Met1 and Gln2) were constructed and cloned to the vector pET-22b by GenScript (Nanjing, China). The plasmids containing S ...
-
bioRxiv - Immunology 2024Quote: ... 1% non-essential amino acids and were treated with macrophage colony-stimulating factor (m-MCSF, GenScript, Cat # Z02930-50, 40 ng/ml) for 6-7 days with media change every three days to differentiate bone marrow cells into mouse bone marrow-derived macrophages (BMDMs).
-
bioRxiv - Molecular Biology 2021Quote: Human langerin CRD WT and all mutants (amino acids 193-328) were cloned from a codon-optimized langerin gene for bacterial expression (GenScript, Piscataway, NJ, USA) into a pET-28a vector (GenScript ...
-
bioRxiv - Biophysics 2022Quote: DNA fragments coding the C-terminal 350 amino acids of E6AP were synthesized as a codon-optimized artificial gene (GenScript, Piscataway, NJ, USA). The products were subsequently ligated into the pET28a vector with NdeI and BamHI restriction enzymes and designated E6APHECT_WT ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Microbiology 2021Quote: ... polyclonal anti-Bma-LAD-2 peptide antibodies were generated by Genscript. Rabbits were immunized with Bma-LAD-2 peptide sequences conjugated to keyhole limpet hemocyanin (KLH) ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding SARS-CoV-2 and other coronavirus S-2P (Genscript) were transiently transfected in FreeStyle 293-F cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Codon-optimized spike of SARS-CoV-2 was purchased from GenScript and subcloned to pcDNA3.1 ...
-
bioRxiv - Immunology 2021Quote: ... SARS CoV-2 Nucleocapsid human chimeric mAb (GenScript, Cat # A02039-100), or in-house antibodies to ORF3a and ORF8 served as positive controls ...
-
bioRxiv - Microbiology 2022Quote: ... An anti-SARS-2 nucleocapsid protein rabbit antiserum (generated by GenScript) was used at a 1:1000 dilution to detect specific anti–SARS-2 immunoreactivity using the Discovery ULTRA automated staining instrument (Roche Tissue Diagnostics ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein-crud (RP30020, GenScript Biotecn Corp). A ten amino acid overlapping peptide mixture pool was prepared ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 spike gene (Wuhan) was synthesized by Genscript for Dr ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 N and S1 proteins were obtained from Genscript and Sino Biological.
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Microbiology 2024Quote: ... The 2-mer and 3-mer oligos were ordered from GenScript USA ...
-
bioRxiv - Biophysics 2024Quote: ... supplemented with DTT (2 mM) and TEV protease (cat. # Z03030, GenScript), and dialyzed against buffer C (50 mM K2HPO4 ...
-
bioRxiv - Biochemistry 2024Quote: ... and SARS-CoV-2 nsp gene sequences were codon optimized (Genscript). Sequences for Gammacoronavirus galli IBV/M41/Y28 proteins originate from the GenBank sequence QWC71293.1 ...
-
bioRxiv - Immunology 2022Quote: ... binding of SARS-CoV2 and control IgG antibodies (at 1 µg/ml) to 15-mer S2 overlapping 5-amino acid peptides (n=52, GenScript Biotech, 500 ng/well) was tested using the same procedure as previously described (Wardemann ...
-
bioRxiv - Biochemistry 2023Quote: ... The gene encoding for the GAF2 domain from All1280 of Nostoc PCC 7120 (NCBI protein ID BAB73237.1, UniProtKB Q8YXD3, amino acids 562-727) was ordered from Genscript (codon optimized for E. coli) in the pUC18 cloning vector ...
-
bioRxiv - Cell Biology 2020Quote: ... Antagonist peptide 1 (SCSLFTCQNGIV) and 2 (SCSLFTCQNGGGWF) were chemically synthesized by Genscript. Anti-Mouse-IgG (H&L ...