Labshake search
Citations for GenScript :
151 - 200 of 722 citations for 3 4 Ethoxy 3 methoxy phenyl 3 thiophene 2 carbonyl amino propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... we constructed HDR plasmids with the egfp-chimeric hiphop-PBacDsRed cassette flanked with one kilobase homology arms 5’ and 3’ of their respective guide RNAs into pUC57-Kan (GenScript, Piscataway, NJ). The cassette consists of the 3xP3-DsRed visible marker (66 ...
-
bioRxiv - Microbiology 2024Quote: ... V165A & R166A)50 and NL4.3(Δ: Δ(105 − 278)&Δ(301 − 332))44 in the HIV-1 proviral clone pNL4-3 were performed by GenScript. For use in electron microscopy ...
-
bioRxiv - Biophysics 2022Quote: ... A 23 amino acid synthetic peptide corresponding to the X-31 FP domain56 was custom synthesized by GenScript, NJ labelled with tetra-methyl rhodamine (Sequence ...
-
bioRxiv - Cell Biology 2021Quote: Fluorescein isothiocyanate (FITC) labeled peptides corresponding to the carboxyl-terminal 10 amino acids of Yhl045w (FITC-RKRVLGVAYL, Genscript) and Idp3 (FITC-YEDKKGMCKL ...
-
bioRxiv - Immunology 2024Quote: ... – BMDC of Pink1−/− mice were stained with Tag-it Violet as described previously and then coated on ice for 3 hours with the mitochondrial peptide pool (custom synthesis by Genscript or Canada Peptide) or mock pool (OVA 257-264 ...
-
bioRxiv - Developmental Biology 2023Quote: ... were also commercially synthesized with 5’EcoRV and 3’SpeI ends and cloned into the pCDNA3.1 vector by Genscript (Genscript USA, Piscataway, NJ). To construct the inducible GR-RFX6 wild type or mutants used in cycloheximide direct target assays ...
-
bioRxiv - Cell Biology 2021Quote: The following peptides corresponding to the Sst2 amino acid sequence surround Serine 539 were synthesized by Genscript (Piscataway NJ), the phospho-Sst2 S539 peptide LHPHSPLSEC ...
-
bioRxiv - Biophysics 2023Quote: ... fused to enhanced yellow fluorescent protein by an 18 amino acid flexible linker (EFC-SRRYRGPGIHRSPTA) was synthesized and cloned into the pcDNA3.1(+) expression vector by GenScript. The Tau4RD*LM-YFP sequence was then subcloned into the pIRESpuro3 vector (Takara ...
-
bioRxiv - Neuroscience 2024Quote: ... human α-synuclein cDNA sequences fused to enhanced yellow fluorescent protein by an 18 amino acid flexible linker (EFCSRRYRGPGIHRSPTA) were synthesized and cloned into the pcDNA3.1(+) expression vector by GenScript. The α-syn140-YFP sequences were then subcloned into the pIRESpuro3 vector (Takara ...
-
bioRxiv - Molecular Biology 2024Quote: sgRNAs with the modification of phosphorothioation and methoxy group were synthesized by GenScript (Nanjing, China) (Supplementary Sequence) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pL7-PfSMC3-3HA-glmS plasmid also contained the homology repair construct 5’- AGATAGAGAGAGTTATATATCTAAAGGAACAAAGAATGAGGCCTACGAAATTATTAGC ATTGTATAAAAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAAAGATTATATATATAAT ATATGTTGACAATTAATAAATATATTTGTATATATCTGTTAACTAATTATGAAAATTTTT GAATCAATAAATTTTTTAAATAACAAAAAAAAAAAAAAATATATATATTATATATATA TTTTATATTTTATATTTTCTTGTAATTTTTGTTTTTTTAGGAGGAAAAACATGCCCTAGA AAATggcggtggaTACCCTTACGATGTGCCTGATTACGCGTAtCCcTAtGAcGTaCCaGAcTAtG CGTACCCtTAtGAcGTtCCgGATTAtGCtcacggggtgTAAGCGGCCGCGGTCTTGTTCTTATTTT CTCAATAGGAAAAGAAGACGGGATTATTGCTTTACCTATAATTATAGCGCCCGAACTA AGCGCCCGGAAAAAGGCTTAGTTGACGAGGATGGAGGTTATCGAATTTTCGGCGGATG CCTCCCGGCTGAGTGTGCAGATCACAGCCGTAAGGATTTCTTCAAACCAAGGGGGTGA CTCCTTGAACAAAGAGAAATCACATGATCTTCCAAAAAACATGTAGGAGGGGACAACA ATTTGGTTTTGTTTTTTTCTTTAGGTTTTGAGAAAAACAAATAGGAAATACAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTATTTTTACATATGCACTTGGATTA TTTTATTTTTATTATTTTTCTTTATATAAAGTAAAAATATACATAAGTATGCTTATTTATT ACATAAGAGTTTATTTAAGAAAGGTTTCTTTTTCATAATATTGTGTGCATGAGTTTTTTT TTATTTTATTTTTTTTTTTTATTTCTGTAACGAAAAGGATATTAAAAAAAATAATAAAA- 3’ (synthesized by GenScript Biotech [Piscataway, NJ, USA]). This homology repair construct comprises a 3 x Hemaglutinin (3HA ...
-
bioRxiv - Bioengineering 2020Quote: Codon-optimized forms of human ACE2 binding region (amino-acids 19-615) and modified ACE2 genes were chemically synthesized (Genscript), and were subcloned upstream of a human Fc region (derived from IgG1 ...
-
bioRxiv - Biophysics 2021Quote: A plasmid expressing mature OmpA without the 22 amino acid signal sequence in the pET303 vector was purchased from Genscript for cloning of the modified loop constructs ...
-
bioRxiv - Cell Biology 2022Quote: ... (amino acids 571-1255) was synthesized and cloned into modified pET23b vector at the AgeI and NotI restriction sites (Genscript). Purification of 6×His-mDia1(FH1-C ...
-
bioRxiv - Molecular Biology 2020Quote: The EPYC1 full-length gene (encoding amino acids 1-317) and corresponding R/K mutant (EPYC1R64A/K127A/K187A/K248A/R314A) were synthesized by GenScript and cloned between the SacII and HindIII site of the pHue vector48 ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse Tmod3 amino acid sequence with locations of peptides (red – Nterm, blue - Cterm) used to custom prepare chicken anti-Tmod3 antibodies (Genscript). A commercial rabbit anti-Tmod3 antibody (Aviva ...
-
bioRxiv - Biochemistry 2022Quote: ... a plasmid containing 400 bp upstream of the VPH1 open reading frame followed by the SPVD chimera and 400 bp corresponding to Vph1CT amino acids 406-539 cloned into pBluescript II KS(-) vector using BamHI and XhoI was purchased from Genscript. After restriction digestion with BamH1 and Xho1 ...
-
bioRxiv - Cell Biology 2024Quote: ... (Biotin-GRMTNGAMNVEIGNPTYKMYEGGEPDDG) and LRP1 (NPXA) (Biotin-GRMTNGAMNVEIGNPTAKMYEGGEPDDG) peptides corresponding to human LRP1 amino acid residues 4458-4483 were purchased from GenScript and ...
-
bioRxiv - Biochemistry 2023Quote: Full-length human BAP1 and the deubiquitinase adaptor domain (DEUBAD) of ASXL1 (amino acids 237-390) were cloned into a pFastBac Dual vector by GenScript. ASXL1 was subcloned into pET24a vector for E ...
-
bioRxiv - Immunology 2023Quote: Full length Erdr1 (Erdr1-177) and Erdr1 deficiency C-terminal 32 amino acid (Erdr1-145) with C-terminal HA tags was synthesized (GenScript) and cloned into pcDNA3.1 plasmid using In-Fusion cloning (Clontech) ...
-
bioRxiv - Cell Biology 2023Quote: The antibody against B55α was generated by immunizing rabbits with a synthetic peptide corresponding to the first 15 amino acids of the N-terminal region of B55α (MAGAGGGNDIQWCFS) conjugated to keyhole limpet hemocyanin (Genscript). The resulting sera were purified with CNBr-activated sepharose 4 Fast Flow (GE Healthcare ...
-
bioRxiv - Genetics 2023Quote: An antibody against CENP-C made in guinea pig was made by generating a clone expressing amino acids 502-939 (Genscript). This guinea pig anti-CENP-C was used at 1:1000 ...
-
bioRxiv - Biophysics 2024Quote: DNA constructs encoding the amino acid sequences of the human Panx1 (hPanx1: gene ID: 24145) and frog Panx1 (frPanx1: 100170473) were synthesized (GenScript) and subcloned into appropriate vectors using a standard molecular cloning techniques ...
-
bioRxiv - Neuroscience 2024Quote: ... from six donors were stimulated with peptide pools of a 15-mer peptide library overlapping by 11 amino acids (GenScript) spanning the entire VP1 protein (GenBank ...
-
bioRxiv - Plant Biology 2024Quote: ... the published amino acid sequence of the mature NCR13 peptide (24) was used for synthesis of the codon-optimized gene (GenScript). The NCR13 gene was expressed in P ...
-
bioRxiv - Biochemistry 2024Quote: ... Human CI-MPR cDNA (amino acids 1-2304) with C-tail HPC4 tag (EDQVDPRLIDGK) codon optimized for CHO expression was ordered from Genscript in pcDNA3.1 plasmid ...
-
bioRxiv - Biochemistry 2024Quote: ... corresponding to amino acids 53-463) fused to a C-terminal hexahistidine tag (two separate pET31a vectors) were purchased from Genscript (all inserts were codon optimized for expression in E ...
-
bioRxiv - Biochemistry 2024Quote: A cDNA encoding the G1 region of human ACAN (Uniprot ID P16112, amino acids 21 – 351) was synthesized by Genscript and cloned into a derivative of the pLex2 vector (45) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lamin-C was overproduced and purified from codon-optimized Lamin-C (amino acid residues 1-152) engineered into pRSF-Duet plasmid (Genscript Inc.). The construct carries a tandem N-terminal Strep-tag ...
-
bioRxiv - Biochemistry 2022Quote: Codon-optimized gene corresponding to 5 to 897 amino acids of KFDV NS5 with an N-terminal Hexa-histidine tag was synthesized (Genscript USA) and sub-cloned into pET-28a (+ ...
-
bioRxiv - Cell Biology 2020Quote: ... Trp68 rabbit polyclonal antibodies were custom generated and affinity purified against the TDP-43 amino acid sequence 65DAGWGNL71 by GenScript (Piscataway, NJ).
-
bioRxiv - Molecular Biology 2021Quote: ... elephas VTG amino acid sequence deduced in silico (Fig. 1A) was used to create two synthetic peptides (Fig 1B) (Genscript USA Inc.) to be employed for the production of specific anti-VTG antibodies (Twin Helix ...
-
bioRxiv - Immunology 2021Quote: ... resuspended at a density of 15 million/mL in complete RPMI and 100 μL of cell suspension containing 1.5 million cells was added to each well of a 96-well round-bottomed tissue culture plate and stimulated ex vivo with a peptide pool consisting of 15mer peptides overlapping by 11 amino acids spanning the S protein (GenScript, Piscataway, NJ), at a concentration of 1.2 μg/mL of each peptide in the presence of 1 μg/mL anti-CD28 ...
-
bioRxiv - Biochemistry 2023Quote: ... and Ub-MCQ (Ub variant with an additional amino acid Cys between Met1 and Gln2) were constructed and cloned to the vector pET-22b by GenScript (Nanjing, China). The plasmids containing S ...
-
bioRxiv - Immunology 2024Quote: ... 1% non-essential amino acids and were treated with macrophage colony-stimulating factor (m-MCSF, GenScript, Cat # Z02930-50, 40 ng/ml) for 6-7 days with media change every three days to differentiate bone marrow cells into mouse bone marrow-derived macrophages (BMDMs).
-
bioRxiv - Bioengineering 2024Quote: ... or 4 μg BMP-2 (Genscript, Piscataway, NJ) per mg GMs ...
-
bioRxiv - Immunology 2020Quote: Synthetic peptides were generated by Fmoc (9-fluorenylmethoxy carbonyl) chemistry to a purity of 85% by Genscript USA ...
-
bioRxiv - Molecular Biology 2021Quote: Human langerin CRD WT and all mutants (amino acids 193-328) were cloned from a codon-optimized langerin gene for bacterial expression (GenScript, Piscataway, NJ, USA) into a pET-28a vector (GenScript ...
-
bioRxiv - Biophysics 2022Quote: DNA fragments coding the C-terminal 350 amino acids of E6AP were synthesized as a codon-optimized artificial gene (GenScript, Piscataway, NJ, USA). The products were subsequently ligated into the pET28a vector with NdeI and BamHI restriction enzymes and designated E6APHECT_WT ...
-
bioRxiv - Biophysics 2020Quote: ... 10 nM NS2B-NS3pro was incubated with the substrate benzoyl-Nle-Lys-Arg-Arg-7-amino-4-methylcoumarin (Bz-nKRR-AMC) (Genscript) at concentrations varying from 2 to 200 µM ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: Michaelis-Menten kinetics of pre-SplB mutants were measured with the peptide substrate Ac-WELQ-AMC (Ac: acetyl-; AMC: 7-Amino-4-methylcoumarin, stock concentration: 26 mM in DMSO, concentration range: 13-1161 μM, Genscript) at an enzyme concentration of 125 nM to 2.5 μM using a Tecan infinite 200Pro (excitation wavelength 339 nm ...
-
bioRxiv - Biochemistry 2024Quote: The peptidase activity of the 20S CP was measured using a pair of substrates: the tripeptide benzyloxycarbonyl-Val-Leu-Arg-7-amino-4-methylcoumarin (Z-VLR-AMC, Genscript) and a 11-residue oligopeptide conjugated to 7-methoxycoumarin-4-acetic acid referred to as LF211 (7-methoxycoumarin4-acetic acid (MCA)-Lys-Lys-Val-Ala-Pro-Tyr-Pro-Met-Glu-(dinitrophenyl)diaminopropionyl-NH2 ...
-
bioRxiv - Immunology 2022Quote: ... binding of SARS-CoV2 and control IgG antibodies (at 1 µg/ml) to 15-mer S2 overlapping 5-amino acid peptides (n=52, GenScript Biotech, 500 ng/well) was tested using the same procedure as previously described (Wardemann ...
-
bioRxiv - Biochemistry 2023Quote: ... The gene encoding for the GAF2 domain from All1280 of Nostoc PCC 7120 (NCBI protein ID BAB73237.1, UniProtKB Q8YXD3, amino acids 562-727) was ordered from Genscript (codon optimized for E. coli) in the pUC18 cloning vector ...
-
bioRxiv - Bioengineering 2024Quote: ... hydrogels of varying Young’s modulus: 5 kPa (4% 20 kDa 4-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript), 12 kPa (5% 40 kDa 8-arm PEG-NB ...
-
bioRxiv - Biophysics 2021Quote: ... lacking its amino-terminally signaling sequence within a pET28b-vector backbone yielding DegP with an amino-terminal His6-Tag (purchased from GenScript). The individual PDZ domains ...
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... Afp18N20EtA (Afp18N20EtA: MPYSSASKAKATHSKATARD, glutamic acids to alanines) were synthesized and subcloned into pET11a_afp18NT20-casΦ-2 (replacing afp18NT20) by Genscript.
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Microbiology 2023Quote: ... BA.2 and BA.4/5 lacking the C-terminal 19 codons (SΔ19) was synthesized by GenScript. The SΔ19 gene of BA.2.75 ...