Labshake search
Citations for GenScript :
151 - 200 of 419 citations for 14 3 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... with 200 μg of recombinant mouse IFN-γ alone (Genscript), 250 μg anti-CD115 (clone ASF98 ...
-
bioRxiv - Immunology 2023Quote: ... Recombinant PDC-E2-ILD was manufactured by Genscript (Piscataway, NJ) using its proprietary E ...
-
bioRxiv - Biochemistry 2023Quote: ... All plasmids for recombinant protein expression were constructed by GenScript.
-
bioRxiv - Physiology 2024Quote: ... recombinant ITPa was independently produced by Genscript (Genscript, Piscataway, NJ) following heterologous expression in a proprietary TurboCHO™ expression system (Genscript ...
-
bioRxiv - Immunology 2020Quote: ... Test serum (1:100 dilution) or the mAb 5B7D7 (1 µg/ml) (GenScript, Piscataway, NJ) was diluted in CSA buffer and incubated for 1 hour at room temperature with 0.1 µg/mL RBD-Fc (BPS Bioscience ...
-
bioRxiv - Immunology 2024Quote: ... – BMDC of Pink1−/− mice were stained with Tag-it Violet as described previously and then coated on ice for 3 hours with the mitochondrial peptide pool (custom synthesis by Genscript or Canada Peptide) or mock pool (OVA 257-264 ...
-
bioRxiv - Developmental Biology 2023Quote: ... were also commercially synthesized with 5’EcoRV and 3’SpeI ends and cloned into the pCDNA3.1 vector by Genscript (Genscript USA, Piscataway, NJ). To construct the inducible GR-RFX6 wild type or mutants used in cycloheximide direct target assays ...
-
bioRxiv - Cancer Biology 2021Quote: ... Recombinant human IFN-α1 (z02866) was purchased from Genscript (Nanjing, China). Recombinant IFN-γ (300-02 ...
-
bioRxiv - Microbiology 2022Quote: ... recombinant human ACE2-IgG-Fc fragments (r-hACE2-Fc) (GenScript, Z03516) were firstly incubated with the Protein-G agarose (Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant human vascular endothelial growth factor-165 (VEGF) was from GenScript, and basic fibroblast growth factor (bFGF ...
-
bioRxiv - Bioengineering 2021Quote: The 14 designs chosen for experimental tests from PIP version 1 were ordered from GenScript pre-cloned into the pET-21a expression vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pL7-PfSMC3-3HA-glmS plasmid also contained the homology repair construct 5’- AGATAGAGAGAGTTATATATCTAAAGGAACAAAGAATGAGGCCTACGAAATTATTAGC ATTGTATAAAAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAAAGATTATATATATAAT ATATGTTGACAATTAATAAATATATTTGTATATATCTGTTAACTAATTATGAAAATTTTT GAATCAATAAATTTTTTAAATAACAAAAAAAAAAAAAAATATATATATTATATATATA TTTTATATTTTATATTTTCTTGTAATTTTTGTTTTTTTAGGAGGAAAAACATGCCCTAGA AAATggcggtggaTACCCTTACGATGTGCCTGATTACGCGTAtCCcTAtGAcGTaCCaGAcTAtG CGTACCCtTAtGAcGTtCCgGATTAtGCtcacggggtgTAAGCGGCCGCGGTCTTGTTCTTATTTT CTCAATAGGAAAAGAAGACGGGATTATTGCTTTACCTATAATTATAGCGCCCGAACTA AGCGCCCGGAAAAAGGCTTAGTTGACGAGGATGGAGGTTATCGAATTTTCGGCGGATG CCTCCCGGCTGAGTGTGCAGATCACAGCCGTAAGGATTTCTTCAAACCAAGGGGGTGA CTCCTTGAACAAAGAGAAATCACATGATCTTCCAAAAAACATGTAGGAGGGGACAACA ATTTGGTTTTGTTTTTTTCTTTAGGTTTTGAGAAAAACAAATAGGAAATACAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTATTTTTACATATGCACTTGGATTA TTTTATTTTTATTATTTTTCTTTATATAAAGTAAAAATATACATAAGTATGCTTATTTATT ACATAAGAGTTTATTTAAGAAAGGTTTCTTTTTCATAATATTGTGTGCATGAGTTTTTTT TTATTTTATTTTTTTTTTTTATTTCTGTAACGAAAAGGATATTAAAAAAAATAATAAAA- 3’ (synthesized by GenScript Biotech [Piscataway, NJ, USA]). This homology repair construct comprises a 3 x Hemaglutinin (3HA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Medium was collected 7 days post-transfection and mAbs were purified using protein A resin (Genscript) affinity chromatography and eluted in PBS (pH 7.4) ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant SARS-CoV-2-RBD (T80302) was obtained from Genscript (NanJing, China). Antagonist peptide 1 (SCSLFTCQNGIV ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 ng/ml mouse recombinant Sonic Hedgehog (SHH)-C25II (Genscript, Z03050-50), and 10 μM CHIR99021 (Sigma ...
-
bioRxiv - Biophysics 2023Quote: ... The constructs for recombinant htt43Q-Cry2-mCherry was custom synthesized by Genscript and subsequently cloned with Golden Gate as described ...
-
bioRxiv - Cell Biology 2019Quote: ... Rat polyclonal antibodies against full-length recombinant GST-tagged PfAlba3 were from GenScript Corporation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant BRD4 N-terminal protein was purchased from GenScript (BRD4-N (49-460aa), His ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Some recombinants were generated by homologous recombination using GenBuilder Kit (GenScript Biotech Corporation) following manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... An IgG2b expression plasmid encoding the K89/34 IgG2b R-mAb was generated to order by Genscript (https://www.genscript.com/) by replacing the mouse IgG2a (ψ2a ...
-
bioRxiv - Cancer Biology 2022Quote: The cloning service of recombinant human HK1b and HK1c isoforms was performed by GenScript Inc (Piscataway ...
-
bioRxiv - Immunology 2021Quote: ... Media supplemented with 10 ng/mL of recombinant human VEGF (GenScript, Piscataway, NJ, U.S.) was used as a positive control ...
-
bioRxiv - Immunology 2020Quote: ... human recombinant IL-2 (10 U/well) and with or without SIINFEKL peptide (Genscript) at 0.2ug/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with the recombinant plasmid carrying the human TDP1 gene (GenScript, OHU22350D) using PEI transfection reagent as previously described (Popovic et al. ...
-
bioRxiv - Microbiology 2023Quote: The full recombinant MPL36 protein (rMPL36/aa 41-321) was commercially produced by GenScript® Biotech with His-tag in an E ...
-
bioRxiv - Biophysics 2020Quote: The codon-optimised gene encoding DENV2 NS3pro (residues 14–185, based on the accession number ARO84675.1) was synthesized by GenScript and ligated into pSKDuet01 using the sites NcoI and XhoI ...
-
bioRxiv - Microbiology 2020Quote: The IgG heavy and light chain variable genes of CB6 mAb (GenBank: MT470196 and MT470197) were human codon-optimized and synthesized by Genscript and cloned into antibody expression vectors.
-
bioRxiv - Bioengineering 2021Quote: ... 2 mM CaCl2) using 10 U of Recombinant Bovine His6-Enterokinase (GenScript, Piscataway, NJ, USA) overnight at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: cDNA constructs for expression of recombinant Mac-1 in mammalian cells were generated by GenScript. ITGAM cDNA was cloned into the vector pcDNA3.1/HygroB(+) ...
-
bioRxiv - Microbiology 2023Quote: ... enterica Tsr LBD construct for recombinant protein expression was performed as a service by Genscript Biotech Corp ...
-
bioRxiv - Biophysics 2021Quote: ... to produce antibodies, peptides corresponding to mouse C2CD6 (ALS2CR11) (359-377, EKLREKPRERLERMKEEYK) (Open Biosystems) and SLCO6C1 (1-14, MAHVRNKKSDDKKA) (GenScript) were synthesized and conjugated to KLH carrier protein ...
-
bioRxiv - Microbiology 2019Quote: ... Rabbit (Genscript, #A00174) in Blocking Solution for 60 min at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... or rabbit (GenScript, Nanjing ...
-
bioRxiv - Microbiology 2020Quote: ... Blocking buffer was removed and replaced with 20 mL blocking buffer supplemented with 4 μL anti-HIS primary antibody (mAb, mouse, GenScript®) and the blot was incubated overnight at 4°C with agitation ...
-
bioRxiv - Bioengineering 2022Quote: ... The experiments were performed by direct immobilization of the recombinant IL6 protein (Cat. No. Z03034, Genscript), on a CM5 biosensor chip surface (Cytiva ...
-
bioRxiv - Immunology 2021Quote: ... human recombinant IL-2 (10 U/well) and with or without NP311 or NP366 peptides (Genscript) at 0.2ug/ml ...
-
bioRxiv - Immunology 2022Quote: ... B2 F and hMPV B2F-GCN4 recombinant proteins were synthesized from the plasmids obtained from GenScript cloned into pcDNA3.1+ vector ...
-
bioRxiv - Immunology 2019Quote: ... The PIFS model employed by our group involves the tail vein injection of 100μL of a 1mg/mL solution of VP2121-130 peptide (FHAGSLLVFM) in PBS at either 7 or 14 days after the original TMEV infection (GenScript, Nanjing) [38-43] ...
-
bioRxiv - Microbiology 2019Quote: ... The GII.4 Sydney 2012 variant specific-mAbs (1C10, 6E6, 17A5, and 18G12) were developed from mice immunized with RockvilleD1 strain VLP (GenScript, NJ, USA). HBGA-blocking assays were performed using mutant and wild-type VLPs ...
-
bioRxiv - Bioengineering 2021Quote: Recombinant human GILT-R37A-GAA protein was produced in HD Chinese hamster ovary cells and purified (Genscript). Cell culture supernatant was centrifuged ...
-
bioRxiv - Microbiology 2020Quote: ... The recombinant proteins were subjected to SDS-PAGE followed by immunoblotting using anti-HAT-tag antibody (GenScript) and HRP-conjugated anti-rabbit IgG (Jackson ImmunoResearch) ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti Tbx20 (Genscript). Secondary antibodies were Alexa Fluor 488 goat anti-mouse IgG H+L (Thermo #A11001) ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit α-GFP (GenScript) and rabbit α-Dcp-1 (Asp216 ...
-
bioRxiv - Microbiology 2022Quote: ... Rabbit IgG Control (GenScript).
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant protein was eluted using 20 column columns purification buffer supplemented with 1 μM DYKDDDDK FLAG peptide (Genscript). Affinity purification of the TSEN-STREP construct was carried out using the STREP tag carried by the TSEN2 subunit ...
-
bioRxiv - Microbiology 2021Quote: Plasmid constructs to produce recombinant proteins were made with a combination of synthesized DNA fragments (GenScript Biotech, Netherlands) and PCR amplicons using extracted culture gDNA as a template ...
-
bioRxiv - Biochemistry 2024Quote: ... SWR1C was eluted by nutating resin in 1 mL B-0.1 with 0.5 mg/mL recombinant 3xFlag peptide (Genscript) for 1 hour twice in series ...
-
bioRxiv - Cell Biology 2020Quote: ... and Anti-PfAldolase Rabbit (GenScript) (marker for soluble fraction).
-
bioRxiv - Immunology 2022Quote: ... and rabbit anti-FLAG (Genscript); 4 ...
-
bioRxiv - Biochemistry 2020Quote: ... goat anti-rabbit/HRP (Genscript) and rabbit anti-mouse/HRP (DAKO)-conjugated secondary were incubated with the blots to detect GBA2 (rabbit polyclonal antibodies ...