Labshake search
Citations for GenScript :
101 - 127 of 127 citations for n4 Benzoyl 5 methyldeoxycytidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... ATAD1 was diluted in 2-fold dilution series and incubated with 100 nM fluorescently-labeled peptide (P13: 5-FAM-FSRLYQLRIR, purchased from Genscript) for 20 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Microbiology 2024Quote: ... The CRISPR array extended with a BsrG1 restriction site at the 5’ end was synthesized in pUC19 (GenScript Biotech, Netherlands).
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Biochemistry 2024Quote: ... The reaction was stopped at different time points by adding Laemmli sample buffer and incubating the samples 5 min at 95 °C before loading them on Bis-Tris-SDS 4-20% polyacrylamide gels (SurePAGE, GenScript).
-
bioRxiv - Bioengineering 2023Quote: ... and Cellulose synthase 5 (CesA5) gene from moss (Physcomitrella patens) carrying a C-terminal dodeca-HIS-tag [23] was custom synthesized from GenScript and cloned into yeast expression vector pPICZA ...
-
bioRxiv - Microbiology 2023Quote: ... and Omicron BA.5 spike were based on the codon-optimised spike sequence of SARS-CoV-2 and were generated by GenScript Inc ...
-
bioRxiv - Immunology 2023Quote: ... The full-length BQ.1.1 S construct containing a 21 amino acid C-terminal deletion was generated by mutagenesis of the BA.4/5 S construct by Genscript.
-
bioRxiv - Neuroscience 2024Quote: ... denatured for 5 min at 95°C and electrophoresed on a 4-12% Bis-Tris Sure PAGE (GenScript, Piscataway, NJ) with the molecular weight marker (Prime-Step Prestained ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 100 µl of MaSC medium (DMEM/F12 containing 5% FBS, 10 ng/ml EGF [Novoprotein, C029], 20 ng/ml FGF2 [GenScript, Z03116] ...
-
bioRxiv - Microbiology 2021Quote: ... Lysed cells were denatured with SDS at 95°C for 5 min and separated on an 10% SDS PAGE (SurePAGE Bis-Tris, 10×8, GenScript, M00666) at 200V for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... After clearance by ultracentrifugation (45 min, 120,000 g) the lysates were incubated with either FLAG-antibody- coated beads (Genscript, L004332-5) or Strep-Tactin®XT 4Flow high capacity resin (IBA life sciences ...
-
bioRxiv - Biochemistry 2022Quote: Codon-optimized gene corresponding to 5 to 897 amino acids of KFDV NS5 with an N-terminal Hexa-histidine tag was synthesized (Genscript USA) and sub-cloned into pET-28a (+ ...
-
bioRxiv - Cancer Biology 2023Quote: ... with an empty vector (PC) or a vector against Bach1 with the following gRNA 5’ GCGGTTCCGAGCCCACCGCT 3’ (GenScript Biotech Corporation, USA) (BACH1 KO ...
-
bioRxiv - Microbiology 2021Quote: ... pH 7.5) containing 3 % (w/v) skim milk powder and incubated with a rabbit anti-SLPMh 133-147 primary antibody (GenScript, Leiden, Netherlands), diluted 1:200 in TBS (10 mM TRIS ...
-
bioRxiv - Immunology 2020Quote: ... derived from a peptide scan [15-mers with 11 amino acid overlap] through Spike glycoprotein of SARS-CoV-2) (JPT, Cat: PM-WCPV-5 or GenScript, Cat: RP30020). Phorbol Myristate Acetate (PMA ...
-
bioRxiv - Synthetic Biology 2022Quote: DNA chunks comprising ∼5-10 Kb of each megachunk were synthesized and sequence verified by Genscript (megachunks A-K and N-X), GeneArt (megachunks L ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... sgRNA template sequences of the format: 5′-GGAGAACCACCTTGTTGG-(N)20-GTTTAAGAGCTAAGCTGGAAAC-3′ were synthesized in a pooled format on microarray surfaces (GenScript Biotech, Inc.). Oligo pools were PCR-amplified using Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Additional 5’ (GCTAGCA) and ‘3 sequences (CTTAAG) were added to the cDNA to carry out the cloning procedure (GenScript, Piscataway, NJ, USA). The inactive UGGT1 D1454A variant was generated with direct mutagenesis by GenScript ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we constructed HDR plasmids with the egfp-chimeric hiphop-PBacDsRed cassette flanked with one kilobase homology arms 5’ and 3’ of their respective guide RNAs into pUC57-Kan (GenScript, Piscataway, NJ). The cassette consists of the 3xP3-DsRed visible marker (66 ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Developmental Biology 2023Quote: ... were also commercially synthesized with 5’EcoRV and 3’SpeI ends and cloned into the pCDNA3.1 vector by Genscript (Genscript USA, Piscataway, NJ). To construct the inducible GR-RFX6 wild type or mutants used in cycloheximide direct target assays ...
-
bioRxiv - Biochemistry 2024Quote: ... and the supernatant was loaded onto a gravity Ni-NTA column (2-5 ml Ni-charged resin FF from GenScript, Cat# L00666-25). The Ni-NTA column was washed and then the His-tag fused protein was eluted using step-gradient of imidazole (50 ...
-
bioRxiv - Immunology 2022Quote: ... binding of SARS-CoV2 and control IgG antibodies (at 1 µg/ml) to 15-mer S2 overlapping 5-amino acid peptides (n=52, GenScript Biotech, 500 ng/well) was tested using the same procedure as previously described (Wardemann ...
-
bioRxiv - Immunology 2021Quote: ... One million cells per well were added to a U-bottom 96-well plate and were stimulated with 5 μg/ml of pools of overlapping SARS-CoV-2 S protein peptides (GenScript USA Inc, Piscataway, NJ). The stimulation was performed by incubation for 6 h at 37°C and 5% CO2 in the presence of Protein Transport Inhibitor Cocktail (brefeldin A ...