Labshake search
Citations for GenScript :
101 - 150 of 561 citations for SpectraDye Antibody Labeling Kit 650 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The primary antibodies include anti-229E nucleocapsid mouse monoclonal (Eurofins Ingenasa, Spain) and anti-229E spike rabbit polyclonal antibodies (Genscript, USA).
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then incubated overnight at 4 °C with primary antibodies at 1:100 dilution in PBST and 1 % BSA [SARS-COV-2 Spike S1 antibody (#HC2001 GenScript - #A02038), p62 antibody (#BD 610832) ...
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Biochemistry 2022Quote: ... PVDF membranes were cut and immunoblotted with α-TatA and α-TatB antibodies respectively followed by HRP-conjugated α-rabbit antibody (GenScript). Proteins were visualized using ProSignal Pico ECL Western Blotting detection kit (Genesee Scientific).
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was run on separate 12% SDS–polyacrylamide gel and probed using βarr antibody and HRP-coupled protein L antibody (dilution-1:2,000; GenScript; cat. No. M00098) by western blotting ...
-
bioRxiv - Plant Biology 2020Quote: ... and detected with anti-Myc antibodies (Genscript, #A00704 www.genscript.com) and ECL Plus chemiluminescent substrate (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2021Quote: ... a 1:200 biotinylated anti-Strep tag antibody (GenScript) treatment was followed by a 1:400 Streptavidin-BrilliantViolet 421 conjugate (Biolegend) ...
-
bioRxiv - Bioengineering 2022Quote: ... An HRP-conjugated anti-camelid VHH antibody cocktail (Genscript) was diluted 50,000-fold in block and 100 μL/well was added to the ELISA plates for 50 minutes with shaking ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were stained with mouse anti-HA antibody (Genscript) diluted 1:500 in PBS supplemented with 0.5% goat serum and 0.01% Tween-20 (Sigma ...
-
bioRxiv - Cancer Biology 2019Quote: Custom rat anti-KRAS4A antibody was developed by Genscript using the peptide sequence CEIRQYRLKKISKEEK as antigen for immunization..
-
bioRxiv - Biochemistry 2019Quote: ... The anti-POR antibody was from Genscript (NJ, USA).
-
bioRxiv - Cancer Biology 2019Quote: ... while anti-aTubulin antibody (#A01410) was obtained from Genscript. All other reagents if not specified were obtained from Thermofisher Scientific.
-
bioRxiv - Immunology 2021Quote: ... Flag-tag specific mouse antibody (Genscript, catalog no: A100187) and HA-tag specific rabbit antibody (Cell Signaling ...
-
bioRxiv - Microbiology 2020Quote: ... and probed with a custom anti-NifD antibody (GenScript) overnight ...
-
bioRxiv - Microbiology 2020Quote: ... Primary polyclonal antibodies for Cfp29 were generated by GenScript USA Inc via immunization of rabbits with three peptides from the protein sequence ...
-
bioRxiv - Microbiology 2020Quote: ... and anti-HA goat polyclonal antibody (GenScript, A00168-40). The secondary antibodies ...
-
bioRxiv - Microbiology 2020Quote: The anti-LmrC(2) antibody was generated by GenScript USA Inc ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-Clorf109 monoclonal antibody was purchased from Genscript company (Nanjing ...
-
bioRxiv - Microbiology 2021Quote: ... and monoclonal antibody (clone ID: 6D11F2) were from GenScript® ...
-
bioRxiv - Plant Biology 2022Quote: ... using anti-StTGA2.1 antibodies (diluted 1:4.000, GenScript, USA). Additionally ...
-
bioRxiv - Molecular Biology 2022Quote: ... MonoRabTM HRP Rabbit anti-Camelid VHH antibody (GenScript #A01861) was used to detect vhhGFP fusion proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... A custom RHINO polyclonal antibody was outsourced from GenScript using the recombinant protein described in the “Protein purification section” with 6xHIS tag retained and produced in rabbit (GenScript ...
-
bioRxiv - Plant Biology 2023Quote: Rabbit polyclonal antibodies were obtained from GenScript (NJ, USA). Epitopes were chosen based on the manufacturer’s prediction algorithm results in regions that were covered by the protein sequencing ...
-
bioRxiv - Biochemistry 2022Quote: ... Antibodies were custom-made by GenScript (New Jersey, USA), using the sequences provided in the Supplementary source data.
-
bioRxiv - Microbiology 2023Quote: ... rabbit immunization and antibody purification were conducted by Genscript Co ...
-
bioRxiv - Immunology 2023Quote: ... A SARS-Cov-2 neutralizing monoclonal antibody (GenScript #A02057) was used as a positive control at a starting concentration of 3.2 ng/µL ...
-
bioRxiv - Immunology 2023Quote: ... with MonoRab™ Rabbit Anti-Camelid VHH Antibody (GenScript) diluted 1:250 in coating buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-FLAG antibody conjugated to iFluor 488 (GenScript A01809) at 1:2,000 dilution ...
-
bioRxiv - Developmental Biology 2023Quote: The guinea pig Zfh1 antibody was generated by GenScript. Recombinant antigen consisting of amino acids 648-775 of Zfh1 isoform PB was produced with an N-terminal His-tag used for purification ...
-
bioRxiv - Biochemistry 2024Quote: ... anti-Strep-tag antibody (Genscript #A01732, ; 1:2,000 dilution), anti-FLAG-tag antibody (Sigma #F1804 ...
-
bioRxiv - Microbiology 2024Quote: ... and incubated with a α-HIS antibody (Genscript A00186), followed by HRP-conjugated α-mouse antibody (Abclonal AS003) ...
-
bioRxiv - Microbiology 2024Quote: ... A custom primary antibody for Imp1 (α-Imp1, Genscript), a commercial primary FLAG antibody (α-FLAG ...
-
bioRxiv - Genomics 2024Quote: ... The polyclonal antibody was purified by affinity column (GenScript). No cross reactivity against the host cell lysates was seen by western blots (Supplementary figure 13B) ...
-
bioRxiv - Microbiology 2022Quote: ... Heterologous expression was detected by electroblotting SDS-PAGE Tris-glycine gels onto nitrocellulose membranes and immunostaining with primary rabbit anti-His-tag antibody and secondary goat anti-rabbit IgG phosphatase alkaline conjugated antibody (GenScript, Piscataway, NJ, USA) (Suppl ...
-
bioRxiv - Immunology 2023Quote: ... a biotinylated rat polyclonal antibody against human Fc was used as a capture antibody and anti-human IgG Fc-HRP (GenScript Cat# A01854-200) as a detection antibody ...
-
bioRxiv - Cell Biology 2023Quote: ... The membrane sections were then incubated overnight at 4°C with the corresponding antibody: anti-ChmA (dilution = 1:500; custom GenScript polyclonal rabbit antibody), HRP-conjugated mouse anti-RpoB (dilution = 1:5,000 ...
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Biochemistry 2023Quote: ... the expression levels of each mutant series and their wild-type version were normalized for comparison purposes by quantitation via western blots against the 6xHis tags present at the C-termini of all constructs (Antibody: anti-His-Tag Antibody coupled with iFlour 488, Genscript, A01800, 1:500 dilution). Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Developmental Biology 2020Quote: ... custom made rabbit anti-chick MMP13 antibody (1μg/ml, Genscript), rabbit anti-CXCL14 (0.2 μg/ml ...
-
bioRxiv - Immunology 2022Quote: ... Horseradish peroxidase labeled mouse anti-His tag antibody (GenScript: A00186) was added for 30 minutes at 1:1000 dilution ...
-
bioRxiv - Biochemistry 2022Quote: ... 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984), 1:1000 anti-HA-Tag (C29F4 ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-mouse ZIP14 antibody was custom made by Genscript. Antibodies for GAPDH and actin were obtained from Cell Signalling.
-
bioRxiv - Microbiology 2021Quote: ... Polyclonal antibodies against OVA or SV40 were obtained from GenScript (GenScript ...
-
bioRxiv - Microbiology 2022Quote: ... in-house custom rabbit anti-RVFV nucleoprotein polyclonal antibody (Genscript) and anti-pan cytokeratin typeI/II anti-cytokeratin polyclonal antibody (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... Mouse Anti-Rabbit IgG Fr secondary antibody (GenScript, Piscataway, NJ) 1:30,000 was used for assays of these rabbit-derived samples ...
-
bioRxiv - Microbiology 2021Quote: ... for SyNOS and a specific OtNOS antibody generated by GenScript Company.
-
bioRxiv - Plant Biology 2019Quote: ... and incubated with anti-c-Myc primary antibody solution (GenScript, 1 ...