Labshake search
Citations for GenScript :
101 - 150 of 210 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: Arhgef11CA with a membrane targeting domain and an HA tag with a stop code on the C-terminal was synthesized by GenScript. NheI and Sal I sites were inserted on the 5’ and 3’ ends of the Arhgef11CA cassette ...
-
bioRxiv - Biophysics 2021Quote: ... Both ghrelin receptor–Gq complexes were formed on the membrane in the presence of 10 μM ligands (ghrelin or GHRP-6, synthesized by GenScript) and treated with apyrase (25 mU/ml ...
-
bioRxiv - Bioengineering 2022Quote: ... Membranes probed with HRP-conjugated secondary were developed with a 3,3’,5,5’-teramethylbenzidine (TMB) substrate (Genscript L0022V or Sigma T0565). Developed membranes were scanned and analyzed with ImageJ (National Institutes of Health) ...
-
bioRxiv - Microbiology 2020Quote: ... the fixed cells were labeled with primary antibodies including goat anti-major outer-membrane protein (MOMP; Meridian, Memphis, TN) and mouse or rabbit anti-six histidine tag (Genscript, Nanjing ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were blocked and incubated with primary antibodies and secondary antibodies using eZwest Lite Automated Western Device (GenScript Biotech, China). Membranes were then incubated with Omni-ECL™Femto Light Chemiluminescence Kit (Epizyme ...
-
bioRxiv - Cancer Biology 2024Quote: ... Gels were transferred to a PVDF membrane using the eBlot™ L1 Fast Wet Transfer System (GenScript, Piscataway, NJ, USA). Membranes were blocked in 5% non-fat dry milk in 1× TBST rocking for 1hr at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: The pull-down assays were executed using 25 μL of streptavidin-coated magnetic beads (Magbeads streptavidine, Genscript) loaded with 1 nmol of the biotinylated bait-peptides of interest ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes probed with HRP-conjugated secondary antibody were developed a 3,3’,5,5’-teramethylbenzidine (TMB) substrate (Genscript L002V or Millipore Sigma T0565). Developed membranes were scanned and then processed with ImageJ.
-
bioRxiv - Microbiology 2024Quote: ... the membranes were incubated with an anti-Strep tag II antibody (THE™ NWSHPQFEK Tag Antibody, GenScript, USA, 1:1000 dilution) to detect Strep-tagged nsp1 and with an anti-GAPDH mouse-antibody (1:1000 dilution ...
-
bioRxiv - Immunology 2021Quote: ... All neutralization assays performed with the surrogate Virus Neutralization Test (sVNT) (cat. n° L00847, GenScript, Piscataway, NJ, USA) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Immunology 2021Quote: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA ...
-
bioRxiv - Immunology 2021Quote: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA ...
-
bioRxiv - Biochemistry 2022Quote: ... PVDF membranes were cut and immunoblotted with α-TatA and α-TatB antibodies respectively followed by HRP-conjugated α-rabbit antibody (GenScript). Proteins were visualized using ProSignal Pico ECL Western Blotting detection kit (Genesee Scientific).
-
bioRxiv - Immunology 2021Quote: Purified RBD was loaded at 0.2 µg/well and electrophoretically separated by SDS-PAGE under non-reducing conditions and transferred to nitrocellulose membranes using an e-blot device (GenScript Laboratories, USA). The membranes were blocked with 5% (w/v ...
-
bioRxiv - Developmental Biology 2024Quote: ... the membranes were incubated overnight at 4°C with anti-zebrafish Ybx1 primary antibody we prepared previously (1:2000) (GenScript, Nanjing, China) (26) ...
-
bioRxiv - Microbiology 2022Quote: ... Toxin preparations were tested for lipopolysaccharide (LPS) contamination with the Toxin Sensor Chromogenic LAL Endotoxin Assay following the manufacturer’s instructions (GenScript). SEC preparations had < 0.02 ng of LPS per 20 µg of SEC+ ...
-
bioRxiv - Immunology 2023Quote: Determination of IL10-rs3024496 and IRF3-rs2304204 as functional SNPs was achieved using luciferase assay constructs ordered from GenScript. For IL10-rs3024496 ...
-
bioRxiv - Biochemistry 2024Quote: All peptide fragments used for fluorescence polarization (FP) peptide binding assay were custom-synthesized from Genscript (Piscataway, NJ, USA). Fluorescein isothiocyanate (FITC)-labeled salmon calcitonin (sCT ...
-
bioRxiv - Microbiology 2023Quote: ... The solubilized membrane-fraction was loaded on a column containing 1 mL anti-DYKDDDDK (Flag) G1 affinity resin (50% suspension; GenScript, Piscataway, NJ, USA) pre-equilibrated with 3 bed volumes of TBS buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were incubated overnight at 4°C with the following primary antibodies: rabbit polyclonal anti-AQP4 (1:4000, GenScript Biotech, Piscataway, NJ, USA), rabbit polyclonal anti-AQP4ex (1:2000 ...
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Biochemistry 2021Quote: ... The H4 substrate peptide used in the assay corresponds to the first 19 residues of human H4 (NH2-SGRGKGGKGLGKGGAKRHR-COOH; GenScript). In the assay ...
-
bioRxiv - Biochemistry 2022Quote: The N-terminal peptides of ParBpSM (residues 1-27) and ParBP1 (residues 1-30) used in the ATPase assays were synthesized by GenScript. The sequence of ParBpSM1-27 and its variant ParBpSM1-27 K10A were NH2-MIVGNLGAQKAKRNDTPISAKKDIMGD-CO2H (≥97 % purity ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Mpro inhibition assay was performed using the FRET-based fluorescent peptide substrate DABCYL-KTSAVLQ↓SGFRKM-E(EDANS)-NH2 (purchased from Genscript). The assay was standardized with enzyme concentration of 140 nM and 30 µM of fluorescent substrate in Mpro assay buffer containing (20 mM Tris pH 7.3 ...
-
bioRxiv - Microbiology 2021Quote: ... a panel of gH/gL and EphA2 variants to be tested in biophysical assays was ordered as synthetic genes (GenScript) cloned in pcDNA3.1 (+ ...
-
bioRxiv - Cell Biology 2023Quote: All peptides used for binding assays (Data S1) were synthesized with a N-terminal 5-carboxyfluorescien (5-FAM) at >85% purity (GenScript); peptides used for competition studies did not have 5-FAM ...
-
bioRxiv - Microbiology 2023Quote: ... Total protein was quantified using a BCA assay and 50 μg of each sample was prepared for loading onto 12% precast PAGE gels (GenScript). Wet transfers were performed onto 0.45 uM pore-sized PVDF membranes (Immobilon) ...
-
bioRxiv - Biophysics 2022Quote: The fluorescence-based binding assay employed chemically synthesized unlabeled RNA constructs (wt and mutants) prepared in-house and a peptide mimic (Genscript) of the Tat RNA binding domain N-AAARKKRRQRRR-C containing the arginine rich motif (ARM) ...
-
bioRxiv - Immunology 2021Quote: Antibodies inhibiting virus binding to host cell was measured using a commercial RBD-human angiotensin-converting enzyme 2 (hACE2) binding inhibition assay called cPASS™ (GenScript). As per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Fusion proteins were generated for the assay by cloning chlamydial DNA sequences encoding CPAF into a pET30a vector (constructed by Genscript Biotech), resulting in fusion proteins with a hexahistidine (His6 ...
-
bioRxiv - Biochemistry 2023Quote: The transcription template for the BoxB tethered assay is a derivative of our previously described template and was purchased from GenScript (35). The 5′ UTR was replaced with one of two 5′ UTR sequences possessing varying degrees of secondary structure:
-
bioRxiv - Genomics 2023Quote: ... with CloneEZ PCR Cloning Kit (GenScript #L00339). The pLenti-GIII-EF1α-CBX3-Flag-HA ...
-
bioRxiv - Immunology 2024Quote: ... the commercialized ELISA kit (Genscript, Cat#L00871) was used ...
-
bioRxiv - Immunology 2021Quote: SARS-CoV-2-specific T cell responses in rhesus macaque PBMCs were assessed by an IFN-γ ELISPOT assay using recombinant SARS-CoV-2 S1 protein (GenScript, Nanjing, China). Ninety-six-well plates (Millipore ...
-
bioRxiv - Pathology 2022Quote: ... bat sera were screened at a 1:10 dilution using a competitive enzyme linked immunosorbent assay (SARS-CoV-2 sVNT, GenScript, Piscataway, New Jersey) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... using the High-Affinity Antibody Purification Kit (L00404, GenScript) following the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR products were ligated using GenBuilder Cloning Kit (Genscript) into linearized pGL3-Basic (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... endotoxin was removed with the ToxinEraser™ Endotoxin Removal Kit (Genscript), and the endotoxin level was measured using the ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (Genscript ...
-
bioRxiv - Microbiology 2020Quote: ... or with the ONE-HOUR Western™ Standard Kit (Genscript, China).
-
bioRxiv - Immunology 2020Quote: ... were depleted of endotoxin with the ToxinEraser Endotoxin Removal kit (GenScript) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... generated using the GenCrispr sgRNA Screening Kit (L00689; Genscript Biotech Corp.), and diluted to a concentration of 4 uM ...
-
bioRxiv - Microbiology 2022Quote: ... Endotoxin levels were quantified using ToxinSensor™ Chromogenic LAL Endotoxin kit (GenScript) to ensure toxin purity.
-
bioRxiv - Neuroscience 2020Quote: ... with endotoxin levels determined using a LAL chromogenic endotoxin quantification kit (GenScript). Mouse or human α-synuclein fibrils were prepared by incubation of 7 mg ml -1 α-synuclein monomer of the same origin in phosphate-buffer saline for seven days at 37°C with constant agitation ...
-
bioRxiv - Microbiology 2021Quote: ... the cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (Genscript, L00847), was used as directed to detect antibodies that bind competitively to the receptor binding domain (RBD ...
-
bioRxiv - Biochemistry 2022Quote: The commercially available SARS-CoV-2 Neutralization Antibody Detection Kit (cPass, GenScript) was used to identify the presence of RBD neutralizing antibodies in the serum samples from mice immunized with r3CL-pro ...
-
bioRxiv - Developmental Biology 2022Quote: ... Inserts were ligated using GenBuilder™ Cloning Kit (Genscript, Piscataway NJ, USA) into pGL3-Basic (Promega ...