Labshake search
Citations for GenScript :
101 - 150 of 836 citations for N Furan 2 ylmethyl 3 bromo 4 fluoro benzamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Proteins were used to test activity in vitro against N- terminal peptides (Genscript) using 5,5-dithio-bis-(2-nitrobenzoic acid ...
-
bioRxiv - Genetics 2024Quote: ... and bam 3’UTR by Genscript, Inc (Piscataway ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Cell Biology 2023Quote: Western blots were performed using ExpressPlus PAGE Gel 4-12% or 4-20% (GenScript). Proteins were transferred to PVDF membranes (MERCK-Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... Gradient gels (4-12% GenScript) were used in all experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4%-20% (GenScript, M00657) precast gradient gels and transferred to a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-12% gel (GenScript, #M00654) and separated by MOPS buffer (GenScript ...
-
O-GlcNAcylation reduces phase separation and aggregation of the EWS N-terminal low complexity regionbioRxiv - Biochemistry 2021Quote: ... residues 1-264 (N-terminal LCR; LCRN) was synthesized by GenScript (Piscataway, NJ, USA) with codon optimization for expression in Escherichia coli ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA copy number/mL supernatant was assessed using pCDNA3.1(+)-N-eGFP plasmid (GenScript) as standard.
-
bioRxiv - Biochemistry 2021Quote: The gene for N102LT N-terminally fused with tagRFP (gi: 336287738) was synthesised (GenScript) and inserted to unmodified pQlinkN plasmid using restriction enzyme cloning ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse alpha-DG N terminal domain(a-DGN) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Microbiology 2023Quote: Synthetic peptides of P covering the sequence N-EDDIYQLIM-C were obtained from GenScript. The peptide was dissolved in deionised water dosed with a drop of 5 M NH4OH to improve solubility ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were then probed for SEOV N (α SEOV nucleocapsid, custom generated with Genscript) or HTNV N (anti-HTNV nucleocapsid 76–118 ...
-
bioRxiv - Immunology 2024Quote: ... and N genes were integrated into a lentiviral expression plasmid (pGenlenti vector) from Genscript, UK ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Biophysics 2022Quote: ... All constructs were designed with GFPmut1 fused to the N-terminus and synthesized by GenScript. The plasmids were electroporated into P ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pcDNA3.1-FLAG-FNIP1 and the pcDNA3.1+N-eGFP-FLCNΔE510 vectors were generated by Genscript. The pIRES2-FLCN plasmids were kindly provided by Dr ...
-
bioRxiv - Biophysics 2020Quote: ... and FEZ1 peptide (M174-L188, with N-terminal extension containing a cysteine residue (KCGGSGGMMQNSPDPEEEEEVL, Genscript) were labelled with Alexa Fluor 488-C5-maleimide at 1:1 molar ratio in 50 mM Tris ...
-
bioRxiv - Immunology 2020Quote: ... N-terminal biotinylated peptides of PyCSP[NXA] listed in Table 1 were obtained from GenScript and used in epitope mapping ELISAs.
-
bioRxiv - Physiology 2023Quote: ... Tyrosine-substituted (Y134A) and N-terminal (1-96 aa) truncated mutants were purchased from GenScript Biotech (Piscataway ...
-
bioRxiv - Immunology 2024Quote: ... Fine epitope mapping was performed by ordering synthetic peptides with N-terminal biotin residues (Genscript: 17-mer YHHHHHHDYDIPTTENL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Peptides with N terminal acetylation and C terminal amidation were purchased from Genscript (Rijswijk, Netherlands). Peptides were dissolved in DMSO ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Cell Biology 2020Quote: Sequences of full length hsRIPK2 with an N-terminal 3x-Flag tag were synthesized by Genscript and cloned into doxycycline-inducible lentiviral expression vectors (pF_TRE3G_rtTAAd_puro (Takara Bio)) ...
-
bioRxiv - Biophysics 2022Quote: ... which was synthesized with an N-terminal fluorescein label (5-FAM, GenScript USA Inc. Piscataway, NJ). Fluorescence polarization measurements were carried out in black 96-well plates measured on a Wallac Victor 2 Plate Reader (Perkin Elmer) ...
-
bioRxiv - Biochemistry 2020Quote: ... archaeon HeR gene (GenBank ID: KYK26602.1) containing an N-terminal histidine-tag was chemically synthesized (GenScript) and subcloned into the pET21a (+)-vector ...
-
bioRxiv - Neuroscience 2020Quote: NR peptide was synthesized with a N-terminal 5-FAM modification by GenScript (Piscataway, NJ, USA). Hsp70 was titrated in triplicate while the NR-peptide concentration remained constant at 20nM ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Each 7-mer D-peptide with an N-terminal cysteine was synthesized by GenScript (Piscataway, NJ). Peptides were conjugated with IRDye 800CW maleimide (Li-Cor ...
-
bioRxiv - Immunology 2020Quote: ... The S1-N-terminal domain (S1-NTD, amino acids 16-318) was custom synthesized by GenScript. Each protein was expressed with an N-terminal His6-Tag to facilitate purification ...
-
bioRxiv - Microbiology 2024Quote: ... followed by primary staining of cells with rabbit anti-N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse α-DG lacking the N-terminal domain (H30 – A316) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the muscle-specific MCK promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... The N-terminal 3xFlag tag was removed by incubation with the GST tagged Prescission Protease (GenScript) (final 0.01U/ul ...
-
bioRxiv - Biochemistry 2023Quote: N-terminally biotinylated synthetic MUC1 peptide with the sequence biotin-GGS-APDTRPAPG was ordered from Genscript. This was dissolved in PBS and printed on a planar streptavidin-coated SPR chip (P-Strep ...
-
bioRxiv - Plant Biology 2023Quote: ... SCOOP10 and SCOOP12 peptides were labeled with fluorescent 5-FAM at the N-termini (GenScript, China) and the final working concentration of labelled peptides was adjusted to 0.05 μM with ddH2O ...
-
bioRxiv - Microbiology 2023Quote: ... a custom-synthetized N-terminally biotinylated peptide comprising residues Met1 to Gln38 of LmdC (GenScript, USA) was immobilized on the biosensors ...
-
bioRxiv - Microbiology 2024Quote: ... The recN and recA genes were cloned into pK(N)T25 and pUT18(C) vectors (GenScript) to create N– and C-terminal fusions with T25 and T18 fragments (Supplementary Table S1).
-
bioRxiv - Neuroscience 2024Quote: ... and FAT-2 (Genscript) cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215 ...
-
TRANSITION OF PODOSOMES INTO ZIPPER-LIKE STRUCTURES IN MACROPHAGE-DERIVED MULTINUCLEATED GIANT CELLSbioRxiv - Cell Biology 2020Quote: ... IL-4 was from Genscript (Piscataway, NJ).
-
bioRxiv - Microbiology 2023Quote: ... 4%-20% gradient SurePAGE gel (GenScript, #M00657); Tris-MOPS-SDS running buffer (GenScript ...
-
bioRxiv - Immunology 2023Quote: ... or 4-20% gradient gels (GenScript #M00656). Proteins on gels were transferred to nitrocellulose membranes (Bio-Rad #1620115 ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...