Labshake search
Citations for GenScript :
101 - 150 of 315 citations for Human ADH5 siRNA since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: The cDNA encoding wildtype human MRP4 was obtained from GenScript (CloneID: OHu17173) and cloned into a donor plasmid based on the pHTBV1.1 vector73 to generate a construct featuring full-length MRP4 with a C-terminal HRV 3C-cleavable mVenus-tag linked in tandem to a Twin-Strep-tag and a 6xHis-tag ...
-
bioRxiv - Physiology 2023Quote: ... VSMCs were treated with either 1 ng/ml human TNFα (GenScript, Z00100) or 2.4 mM inorganic phosphate in the absence or presence of 0.1μM GSK2656157 (Cayman ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding human HA-ASC and NLRP3-GFP were obtained from GenScript. Flag-NLRP3 or NLRP3-GFP Cys to Ser (CS ...
-
bioRxiv - Cell Biology 2023Quote: ... human NAP1 cDNA was synthesized and cloned in a pcDNA3.1 vector (Genscript), from where it was subcloned into a pGEX-4T1 vector with an N-terminal GST tag followed by a TEV cleavage site (RRID:Addgene_208870) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Human NRP1 (HNPR1) cloned into pCS2+ was purchased from GenScript (Piscataway, NJ). All expression constructs were confirmed by sequencing and Western blot analysis (see below) ...
-
bioRxiv - Biophysics 2022Quote: ... Human TRPV4 constructs in a pcDNA3.1 vector were commercially obtained from GenScript. Expression plasmids encoding for the isolated intrinsically disordered region (IDR) ...
-
bioRxiv - Cell Biology 2024Quote: ... and human Flag-TMX2 (pIRES2-EGFP) were constructed by Genscript (Piscataway, NJ). Dog Flag-Calnexin was previously described (Lynes et al. ...
-
bioRxiv - Biochemistry 2021Quote: The human Sgk3 gene was codon optimized for expression in insect cells (Genscript) and fused to the C-terminus of His10/StrepII-tagged eGFP (A206K monomeric variant ...
-
bioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP) labeled-mouse anti-human IgG-Fc specific (GenScript No. A01854) diluted 1:10,000 in PBST was added (100μl/well ...
-
bioRxiv - Immunology 2021Quote: ... the variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... a plasmid with the human NSMCE2 cDNA was purchased from GenScript (cat # Ohu31586D). The NSMCE2 coding sequence was PCR-amplified to add a Kozak consensus sequence for efficient initiation of translation and flanking KpnI and XhoI restriction sites ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids expressing human KLF family proteins were purchased from Genscript (Piscataway, NJ) or OriGene (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: The human abhd14b gene22 was synthesized as a codon-optimized construct (from Genscript) for expression in E ...
-
bioRxiv - Cell Biology 2024Quote: ... Cdc42 and WAS-GBD were human codon-optimized and gene-synthesized by Genscript and inserted into the pCAGGS plasmid using an NEBuilder assembly kit ...
-
bioRxiv - Biophysics 2024Quote: ... human/mouse codon-optimized genes coding for the identified ChRs were ordered (GenScript, Piscataway ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cloning: Human KRAS-4B ORF (NCBI Reference Sequence NP_004976.2) was synthesized by GenScript and cloned into pUC57 ...
-
bioRxiv - Biochemistry 2020Quote: The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC ...
-
bioRxiv - Cancer Biology 2022Quote: The cloning service of recombinant human HK1b and HK1c isoforms was performed by GenScript Inc (Piscataway ...
-
bioRxiv - Biochemistry 2021Quote: ... codon optimized human DHFR was produced as a 6His-SUMO1 fusion from pET28a (Genscript).
-
bioRxiv - Immunology 2021Quote: ... Media supplemented with 10 ng/mL of recombinant human VEGF (GenScript, Piscataway, NJ, U.S.) was used as a positive control ...
-
bioRxiv - Immunology 2020Quote: ... human recombinant IL-2 (10 U/well) and with or without SIINFEKL peptide (Genscript) at 0.2ug/ml ...
-
bioRxiv - Neuroscience 2023Quote: Custom human TauB and TauE plasmids were created on a pET29b backbone by GenScript on a fee-for-service basis ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with the recombinant plasmid carrying the human TDP1 gene (GenScript, OHU22350D) using PEI transfection reagent as previously described (Popovic et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Biophysics 2023Quote: The γ1 ORF (human ortholog LRRC26) used in this study was obtained from Genscript database and tagged on the C-terminus with 3C protease ...
-
bioRxiv - Biochemistry 2023Quote: Human Mint1 open reading frame and mutant Mint1(D269A/I270A) were obtained from Genscript and cloned into the pcDNA3.1-N-eGFP ...
-
bioRxiv - Biochemistry 2022Quote: ... the DNA coding for the human LRRK1 residues 20 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCGCTGTGTGTCCAGAACGTGCCATGG and the reverse primer TATCCACCTTTACTGTCACCTTCTCTTGCGAGTGCAAGCCTCC ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Biophysics 2022Quote: The full length human PARP1 cDNA cloned in pET28-a(+) was purchased from GenScript, USA ...
-
bioRxiv - Biochemistry 2022Quote: A codon-optimized open reading frame for Human DSS1 (DSS1) was synthesized (GenScript Inc.) with a SUMO protease cleavable N-terminal MVKIH-Strep-6x-HIS-SUMO tag ...
-
bioRxiv - Immunology 2022Quote: ... the four genes for each multispecific antibody were synthesized using human preferred codons (GenScript) and cloned into eukaryotic expression vectors ...
-
bioRxiv - Cancer Biology 2024Quote: ... oeANXA4: Human ANXA4 (NM_001320698.2) in pcDNA3.1+/C-(K)-DYK vector was purchased from GenScript (GenScript Biotech ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and recombinant human vascular endothelial growth factor-165 (VEGF) were from GenScript (Piscataway, NJ). Basic fibroblast growth factor (bFGF ...
-
bioRxiv - Immunology 2022Quote: Both Ixodes IRE1α and TRAF2 were codon optimized for expression in human cell lines (GenScript). Primers listed in Supplemental Table 1 were used to amplify full length I ...
-
bioRxiv - Molecular Biology 2020Quote: ... Codon-optimized nucleotide sequences encoding orthologues of human SM-N100 were previously obtained from GenScript [7] ...
-
bioRxiv - Immunology 2021Quote: ... a 3.5kb fragment of the human CLEC7A promoter region (chr12:10129421-10132905) was synthesized (GenScript) and cloned into the secreted Nano-Glo luciferase vector pNL1.3 (Promega) ...
-
bioRxiv - Microbiology 2020Quote: Human codon-optimized cDNA encoding SARS-CoV-2 S glycoprotein (NC_045512) was synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Biophysics 2022Quote: The mRBD (331-532) codon optimised for human cell expression was synthesized by GenScript (USA) (35) ...
-
bioRxiv - Developmental Biology 2020Quote: Dual-tagged Slit2 was designed using the human Slit2 sequence (NM_001289135.2) and ordered from Genscript Biotech ...
-
bioRxiv - Molecular Biology 2022Quote: We purchased the full-length human LRRK1 gene from Genscript (residues 1-2015, uniprot Q38SD2), codon optimized for Homo sapiens ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Human C-type natriuretic peptide (CNP) and rat atrial natriuretic peptide (ANP) were from GenScript Corp ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli optimized coding sequence for human FMRP (isoform 1) was designed and synthesized by Genscript, and then subcloned into pET His6 MBP TEV LIC cloning vector (1M) ...
-
bioRxiv - Biochemistry 2023Quote: A pcDNA 3.1 plasmid containing the full length human cytoglobin gene was purchased from GenScript. The empty vector control and specific point mutations of this plasmid were also generated by GenScript ...
-
bioRxiv - Microbiology 2023Quote: ... Human and hamster ACE2 (Q9BYF1.2 and GQ262794.1, respectively) were synthesized and cloned into pcDNA3.1+ (GenScript). All DNA constructs were verified by Sanger sequencing (ACGT) ...
-
bioRxiv - Cell Biology 2022Quote: ... Human HSPE1-GFP was cloned into pcDNA3.1 from the HSPE1 (NM_002157.2) ORF Clone (OHu17870D, Genscript). The HSPE1-GFP constructs were transfected into cells using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Cell Biology 2024Quote: Wild-type αSyn cDNA was optimized for expression in human cells and synthesized by Genscript before being cloned into a pcDNA5/FRT/TO/EGFP vector (kind gift from A.M ...
-
bioRxiv - Microbiology 2024Quote: ... LLC to a synthetic NINJ1 peptide comprising the first 76 aa of human NINJ1 (GenScript).
-
bioRxiv - Microbiology 2024Quote: ... The coding sequences of human Tollip and IFNGR1 were obtained from GenScript (catalog number OHU02397D) and Sino Biological (catalog number HG10338-CF) ...
-
bioRxiv - Biochemistry 2020Quote: ... Human codon-optimized HSPH1 fused C-terminally to a Myc-tag was expressed from pcDNA3.1 (Genscript). cDNA encoding wild-type human ubiquitin containing an N-terminal HA-tag was expressed from pRK5-HA (Addgene) ...