Labshake search
Citations for GenScript :
101 - 150 of 505 citations for Glypican 3 GPC3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: All HP1α tagged constructs with a 6x-His tag on the N-terminus were ordered from Genscript. Rosetta competent cells (Millipore Sigma 70954 ...
-
bioRxiv - Cell Biology 2023Quote: The pcDNA3.1-NR2A (catalog #: OHu24642D, NM_000833, human) and the pcDNA3.1-NR1 (catalog #: OHu22255D, NM_007327, human) plasmids were purchased from GenScript. The pcDNA3.1-BiP plasmid was provided by Dr ...
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... All purification steps were monitored either by Coomassie-stained SDS-PAGE or anti-HIS western blot (Genscript #A00186). HMT assays were essentially performed as described in (Frapporti et al. ...
-
bioRxiv - Cell Biology 2021Quote: N-terminally Histidine (His)-tagged Bin1b SH3 from zebrafish was cloned into pET-28a (+) expression vector (GenScript®). Full length zebrafish Cavin4a (Cavin4a-FL ...
-
bioRxiv - Biophysics 2022Quote: ... then synthesized and cloned into the pET26b(+) vector in frame with an C-terminal 6 × His tag (GenScript). BL21 DE3 cells were transformed with the plasmid and grown at 37°C in TB media supplemented with 1 mM MgCl2 ...
-
bioRxiv - Microbiology 2020Quote: ... and then incubated with 45 μL each of 0.1 μg/mL of THE anti-his-HRP (GenScript, A00612) in PBST/BSA for 1 hr at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: Codon optimized human SHIP164 generated by Genscript was amplified using PCR from the pUC57 plasmid and ligated into various mammalian and bacterial expression plasmids ...
-
bioRxiv - Neuroscience 2022Quote: Human Stathmin expression clones were from Genscript (STMN1-OHu14092D ...
-
bioRxiv - Biophysics 2022Quote: Isoform 1 of human SERINC2 (GenScript-OHu23082D) was cloned into pFastBacI with the TEV and STREP cleavage and affinity tags upstream of the gene encoding hSERINC2 ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.04-0.32 picomoles of Tspan12-1D4 and 0.25-2 picomoles of 7xHis-MSP1D1 were probed by Rho anti-1D4 and THE anti-His (GenScript) antibodies respectively ...
-
bioRxiv - Developmental Biology 2022Quote: ... residues A27-T157), human FZD7 CRD (UniProt: O75084, residues Q33-G170), human FZD8 CRD (UniProt: Q9H461, residues A28-T158) were synthesized (Genscript). Human LRP6 P1E1P2E2 (UniProt ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-human IgG peroxidase conjugated (A00166, GenScript, USA) or anti-mouse IgG peroxidase conjugated (A4416 ...
-
bioRxiv - Cancer Biology 2022Quote: ... murine and human CD20 cDNA expression constructs (GenScript) were transiently transfected into 293T cells using lipofectamine (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2022Quote: The H3F3A and H3F3B human cDNA sequences (GenScript) were cloned by using ClaI and EcoRI restriction enzymes into the pSNAPm plasmid (New England Biolabs) ...
-
bioRxiv - Biophysics 2022Quote: The human PEAK3 gene was synthesized by GenScript and subcloned into the pcDNA4/TO vector with a C-terminal 3xFLAG tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human SENP1 cDNA (ENST00000448372.5) was synthesised by GenScript to contain an N terminal FLAG tag and synonymous siRNA resistance mutations to the exon 6 and 12 siRNA used (see table 1) ...
-
bioRxiv - Biophysics 2022Quote: The gene that encodes human SERINC3 (Genscript-OHu02717D) was inserted upstream of a thrombin protease cleavable linker (LVPRGS ...
-
bioRxiv - Cell Biology 2023Quote: ... human NAP1 cDNA was gene-synthesized (by Genscript) and subcloned into a pGEX-4T1 vector with an N-terminal MBP-tag followed by a TEV cleavage site before wild-type NAP1 (RRID:Addgene_208871) ...
-
bioRxiv - Biochemistry 2021Quote: Sic1PY and WW-HECT were purified as previously described10. Human UBE1 (plasmid obtained as a gift from C. Tang, Peking University) and human UBCH5A (obtained from GenScript, China) were expressed as GST fusion proteins from pGEX-4T vectors ...
-
bioRxiv - Biochemistry 2022Quote: Recombinant mEAK-7 from Sus scrofa (uniprot ID: A0A4X1T484) was synthesized in a pET28 vector with N-terminal 6×His tag (GenScript). ArcticExpress competent cells (Agilent ...
-
bioRxiv - Molecular Biology 2020Quote: Codon optimized Gcn5 (S. pombe) with 1 × FLAG was cloned into pET28a in frame with N terminal 6 × HIS tag by GenScript to generate JP-2587.
-
bioRxiv - Molecular Biology 2019Quote: Purified ERα LBD containing amino acids 315-545 used by Brzozowski et al for crystallization16 with a his-tag was custom made (GenScript). All reactions were set up in 20 μL reactions in 96 well plates with purified ERα LBD at a concentration of 0.6 μg/μL and 10x SPYRO orange dye (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... The plasmid encoded an N-terminal 8X His-SUMO-tagged hNatD in the pET-21a vector was obtained from Genscript. Library of Pharmaceutically Active Compounds (LOPAC ...
-
bioRxiv - Biochemistry 2020Quote: The full-length human NatD gene was amplified and cloned into a modified pET-21a(+) vector containing an 8x-His-tag and SUMO protease cleavage site at the N-terminus (Genscript). This pET-21a(+)-hNatD construct was transformed into Escherichia coli BL21 (DE3 ...
-
bioRxiv - Biochemistry 2021Quote: ... gene was codon-optimized and cloned into the p423_GAL1 yeast expression vector as an N-terminal Flag (DYKDDDDK) and C-terminal decahistidine (10X His) tagged fusion protein (GenScript) (Fig ...
-
bioRxiv - Biochemistry 2020Quote: ... coli codon-optimized version of VC1 coding for an N-terminal His-tag and lacking the predicted cTP-coding region (Supplementary File 7) was synthesized (GenScript) and cloned into expression vector pET22b(+ ...
-
bioRxiv - Immunology 2022Quote: The coding sequences for the extraviral domain of VARV A33 with N terminus 6×His tag and C-terminus Avi-tag were synthesized by GenScript and directly cloned into the PET-28a(+) ...
-
bioRxiv - Plant Biology 2020Quote: ... coli codon-optimized gene for Arabidopsis UVR8 was introduced into the pET11a expression vector generating a construct carrying an N-terminal 6×His-tag (Genscript). The construct was verified by DNA-sequencing and transformed into the E ...
-
bioRxiv - Immunology 2021Quote: ... for >1 hour at ambient temperature then incubated with *** μg / protein gel of MonoRab anti-his tag C-term (Genscript) in Intercept T20 (PBS ...
-
bioRxiv - Microbiology 2022Quote: ... pcDNA3.1 encoding CoV-2 Omicron (BA.1) Spike tagged with a His epitope on the N-terminus was synthesized provided by Genscript. pMD2.G encoding VSV-G (12259 ...
-
bioRxiv - Biochemistry 2022Quote: ... The hexahistidine tag and Sso7dmut were cleaved from HIV-1 IN by addition of his-tagged sortase and GGGC peptide (GenScript). The reaction was exposed to nickel resin to remove sortase and any residual uncleaved IN ...
-
bioRxiv - Biochemistry 2022Quote: cDNA encoding His6-TEV-pro-conA sequence was synthesized and sub-cloned into pET28a(+) in framed with the N-terminal His-tag (Genscript), followed by transformation into Rosetta PLysS competent cells (Novagen) ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid encoding Wag31 with an N-terminal 6xHis tag followed by a TEV protease cleavage site (pET-His-TEV-Wag31) was synthesized by Genscript. The Wag31 N-terminal DivIVA domain (Wag311-61 ...
-
bioRxiv - Biochemistry 2023Quote: The R36S mutant His-tagged HGD gene (CRYGD) subcloned into Nde1 and BamH1 sites of pET-30b(+) was purchased from Genscript. The plasmid was transformed into E ...
-
bioRxiv - Immunology 2023Quote: ... The biotinylated SARS-CoV-2 fusion peptide (N’-biotin-DPSKPSKRSFIEDLLFNKVT-C’) and His-tagged HIV Env MPER peptide (N’-NWFDITNWLWYIKSGGSHHHHHHHH-C’) were chemically synthesized by GenScript.
-
bioRxiv - Neuroscience 2022Quote: Purification of His-tagged ArcWT and ArcKR was carried out by a third-party company (GenScript Biotech, New Jersey, USA) using the HD transient expression of recombinant protein – gold system ...
-
bioRxiv - Bioengineering 2023Quote: ... and Cellulose synthase 5 (CesA5) gene from moss (Physcomitrella patens) carrying a C-terminal dodeca-HIS-tag [23] was custom synthesized from GenScript and cloned into yeast expression vector pPICZA ...
-
bioRxiv - Biophysics 2023Quote: The plasmids for the expression of codon optimized versions of G4Ps and variants with N-terminal FLAG-His tags in the pET28a backbone were synthesized by GenScript.
-
bioRxiv - Microbiology 2023Quote: Genes encoding His-tagged ectodomain versions of the HSV-1 gD receptors HVEM (HVEM200t) or nectin-1 (nectin345t) were synthesized by GenScript (GenBank accession numbers AF060231 and U70321 ...
-
bioRxiv - Biochemistry 2024Quote: ... Equivalent aliquots (15 µL) of each fraction were analysed by SDS-PAGE and immunoblotting using anti-His tag antibody (GenScript) overnight at 4°C as per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... gene was codon-optimized and cloned into the p423_GAL1 yeast expression vector as an N-terminal Flag (DYKDDDDK) and C-terminal deca-histidine (10X His) tagged fusion protein (GenScript) (Supplementary Fig ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Cell Biology 2020Quote: ... The human BMI1 sequence (pUC57 vector, GenScript, Leiden, NL) was inserted upstream of the hTERT sequence by enzymatic digestion (XbaI and MluI ...
-
bioRxiv - Microbiology 2019Quote: ... The human TRIM34 cDNA was purchased from Genscript (NM_001003827.1). Human TRIM34 was cloned into pHIV/dTomato using NotI and XmaI sites with an HA tag encoded at the N-terminus ...
-
bioRxiv - Cell Biology 2020Quote: ... TM27 and human IRE1α-TM were synthesized by Genscript. Genes corresponding to the transmembrane peptides with following amino acid sequences ...
-
bioRxiv - Biochemistry 2021Quote: ... Human anti-SP IgG standards (chimera, GenScript, Piscataway, NJ) or human ACE-2 Fc (chimera ...