Labshake search
Citations for GenScript :
101 - 150 of 499 citations for CU 115 CAS 2471982 20 2 98% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: Protein samples were resolved on precast SurePAGE Bis-Tris 4-20% gradient gels (GenScript) or 16% Tris-Glycine gels (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Neutralizing antibodies against the SARS-CoV-2 in hamster blood plasma were determined using the “SARS-CoV-2 Surrogate Virus Neutralization test kit” (GenScript, USA).
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 (D614) and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of pseudovirus infection of cells containing SARS-CoV-2 receptors was performed on serum specimens using two commercially available SARS-CoV-2 LVV-PsN Kit (SC2087A; SC2087L; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of ACE2 binding to SARS-CoV-2-RBD was performed on serum specimens using a commercially available SARS-CoV-2 sVNT Kit (L00847; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... 10-residue SARS-CoV-2 S2 peptide FKEELDKYFK (GenScript) was dissolved in 100% DMSO at 10 mg/mL and then diluted with PBS to 1 mg/mL ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 Nucleocapsid was purchased from Genscript (Z03480). SARS-CoV-1 spike (40634-V08B) ...
-
bioRxiv - Plant Biology 2021Quote: ... flg22 (2 µM; Genscript, Piscataway, Township, New Jersey, USA). All PAMPs were dissolved in 10 mM MgCl2 ...
-
bioRxiv - Microbiology 2022Quote: ... Following the injection of 2 units PreScission Protease (GenScript), the column was sealed and placed on a rotator at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: The anti-LmrC(2) antibody was generated by GenScript USA Inc ...
-
bioRxiv - Immunology 2021Quote: ... using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Immunology 2021Quote: ... using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Neuroscience 2024Quote: ... The mCherry WT- dynamin-2 was constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 surrogate virus neutralization test (GenScript) was used to detect neutralizing antibodies targeting the viral spike (S ...
-
bioRxiv - Immunology 2023Quote: ... 2 µg/mL biotin conjugated Env peptides (GenScript, customized) were added to plates and incubated for 1 hour at RT ...
-
bioRxiv - Plant Biology 2022Quote: ... samples were run on a 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and stained with Fast Silver Stain Kit (Beyotime ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of protein lysates were loaded onto SurePAGE Bis-Tris 4-20% gels (Genscript) and transferred either to
-
bioRxiv - Immunology 2022Quote: ... The samples were then run on the Bolt 4–20% Bis-Tris Plus Gel (GenScript) and western blot was performed ...
-
bioRxiv - Plant Biology 2023Quote: Protein samples were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) or 10% SDS-PAGE gels and electrophoresed at 150 V for 2 h ...
-
bioRxiv - Genomics 2023Quote: Cell lysates from HMLE shLuc and shM2 were separated by 4-20% SDS-PAGE (Genscript) and transferred to a PVDF membrane (10600023 GE) ...
-
bioRxiv - Immunology 2023Quote: ... A standard curve was generated using a serial dilution of the standard (GenScript, A02087-20) with a dilution factor of 1:2 ...
-
bioRxiv - Microbiology 2024Quote: ... the enriched proteins were separated on a gradient gel (GenScript, 4–20% precast polyacrylamide gel) at 120V for 5∼10 min ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Cell Biology 2020Quote: Proteins were separated by SDS-PAGE on 4%-20% MOPS-acrylamide gels (GenScript Express Plus, M42012) and electrophoretically transferred onto Immobilon PVDF membranes (Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... and loaded in each well of a 4-20% SurePAGE™ Bis-Tris gel (M00656, GenScript). Proteins were separated by SDS-PAGE and transferred to a nitrocellulose membrane (1620145 ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-Rab6 Q72L or GST-Rab6 T27N was incubated with 20 µl Glutathione resin (L00206 GenScript) at 4°C overnight ...
-
bioRxiv - Biochemistry 2021Quote: ... A 30-mer oligoribonucleotide template and a 20-mer oligoribonucleotide primer were chemically synthesized by GenScript. The template and primer oligoribonucleotides were annealed by heating the solution to 95 °C and gradually cooling to 4 °C ...
-
bioRxiv - Immunology 2020Quote: ... at 95°C for 5 min and then separated using ExpressPlus PAGE Gels 4-20% (GenScript). Proteins were transferred to a polyvinylidene fluoride (PVDF ...
-
bioRxiv - Developmental Biology 2023Quote: Immunoblot was performed according to a standard procedure using 4%-20% gradient SDS polyacrylamide gels (Genscript). Cells were directly lysed in 4X Laemmli gel loading buffer (Boston BioProducts) ...
-
bioRxiv - Genetics 2023Quote: Proteins were separated by SDS-PAGE on 4%-20% MOPS-acrylamide gels (GenScript Express Plus, M42012) and electrophoretically transferred onto PVDF membranes ...
-
bioRxiv - Neuroscience 2024Quote: ... 30-50 μg of protein were loaded on or ExpressPlus™ PAGE 4–20% gels (GenScript), in MOPS running buffer or 7.5% ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins were separated by SDS-PAGE using 4%-20% MOPS-acrylamide gels (GenScript Express Plus M42012) and transferred electrophoretically onto Immobilon PVDF membrane (Merck) ...
-
bioRxiv - Molecular Biology 2024Quote: Proteins were electrophoresed in a 4-20% SurePAGE gel and Tris-MOPS-SDS running buffer (GenScript). Proteins were transferred to a nitrocellulose membrane in wet conditions (25 mM Tris base ...
-
bioRxiv - Cell Biology 2024Quote: ... Serum-free medium containing 20 ng/ml platelet-derived growth factor-BB (PDGF-BB) (Z02892, GenScript) was used to trigger Erk1/2 activation ...
-
bioRxiv - Cell Biology 2024Quote: ... equal amounts of proteins were loaded and separated on a 4-20% SDS–PAGE (GenScript, M42015C). The proteins were transferred to PVDF membrane (Cytiva ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and 2 mL Protein A slurry (1 mL resin, GenScript) was deposited in the columns ...
-
bioRxiv - Immunology 2022Quote: ... DNA encoding SARS-CoV-2 HexaPro Spike was synthesized (Genscript) and transiently transfected in FreeStyle 293F cells (Thermo Fisher ...
-
bioRxiv - Immunology 2020Quote: ... and 0.6 μg/mL SARS-CoV-2 S-ECD (GenScript). After washes with PBST (SMART-Lifesciences) ...
-
bioRxiv - Physiology 2022Quote: ... The WT dynamin-2 mCherry plasmid were constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Immunology 2023Quote: ... plus 10 ng/mL of mouse IL-2 (Z02764, Genscript) in 2 mL complete RPMI1640 medium for 72 h.
-
bioRxiv - Microbiology 2022Quote: ... SDS-PAGE was performed using 30 μ l of sample with 4-20% Bis-Tris gels (Genscript) in Tris-MOPS-SDS running buffer (Genscript) ...
-
bioRxiv - Cell Biology 2020Quote: ... A total of 40 µg proteins were separated by 4-20% gradient SDS-PAGE gels (GenScript, M42015C) and transferred to PVDF membranes (Millipore ...
-
bioRxiv - Cell Biology 2024Quote: A total of about 75 ng of proteins were loaded on 4-20% acrylamide gels (GenScript, M00655) and run at 120 V for 90’ in commercial Tris-MOPS-SDS running buffer (GenScript ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein samples (20-40 μg) were then loaded and separated on SDS-polyacrylamide gradient gels (GenScript, M00654) followed by the transfer to polyvinylidene difluoride membranes (Merck ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Microbiology 2021Quote: ... polyclonal anti-Bma-LAD-2 peptide antibodies were generated by Genscript. Rabbits were immunized with Bma-LAD-2 peptide sequences conjugated to keyhole limpet hemocyanin (KLH) ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding SARS-CoV-2 and other coronavirus S-2P (Genscript) were transiently transfected in FreeStyle 293-F cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...