Labshake search
Citations for GenScript :
101 - 150 of 1087 citations for 6H Imidazo 4 5 e 2 1 3 benzothiadiazole 7 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... standard curves were generated using a synthetic plasmid containing a segment of the E-gene (GenScript) and interpolation was performed as described by Feld et al.71 ...
-
bioRxiv - Immunology 2020Quote: ... derived from a peptide scan [15-mers with 11 amino acid overlap] through Spike glycoprotein of SARS-CoV-2) (JPT, Cat: PM-WCPV-5 or GenScript, Cat: RP30020). Phorbol Myristate Acetate (PMA ...
-
bioRxiv - Molecular Biology 2024Quote: ... mouse anti-Strep-tag (IBA, 2-1507-001, 1:1,000) rabbit anti-CBP-tag (GenScript, A00635-40, 1:1,000), mouse anti-V5-tag (Proteintech Group ...
-
bioRxiv - Biophysics 2020Quote: The gene corresponding to residues 1-201 of colicin 5 (colE5-T) was synthesized (GenScript) and cloned into pET21(+ ...
-
bioRxiv - Microbiology 2021Quote: ... The “i6×7” intron (GenBank: AF179904.1 nucleotide 2988 to 3740) was synthesized by Genscript. The K18JAX (originally named K18i6×7PA ...
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were pretreated with interleukin 4 (IL-4) (Cat. # Z02925-10, GenScript) at a concentration of 5 ng/ml for 24h ...
-
bioRxiv - Biochemistry 2020Quote: ... Rpc5-WH3/4 and Rpc5-WH1/4 from its genomic DNA (Genscript). The constructs were subsequently cloned into pOPINF or pOPINJ plasmids for bacterial expression or into pACEBac1 plasmid for baculovirus–insect cells expression ...
-
bioRxiv - Biochemistry 2022Quote: The 10 C-terminal residues of Caulobacter crescentus RNase E (EKPRRGWWRR) (GWW peptide) were synthesized by GenScript with C-terminal amidation and dissolved in Milli-Q water ...
-
bioRxiv - Immunology 2020Quote: The SARS-CoV-2 pseudovirus was produced by co-transfection of HEK293T cells with 1:1 ratio of DNA plasmid encoding SARS-CoV-2 S protein (GenScript) and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent ...
-
bioRxiv - Immunology 2023Quote: Genes coding for SARS-CoV-2 Spike (S) ectodomains (Hu-1 and BA.1) with Hisx8 and Strep tags were synthesized by Genscript and cloned into the pcDNA3.1(+ ...
-
bioRxiv - Microbiology 2024Quote: ... followed by primary staining of cells with rabbit anti-N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Biochemistry 2019Quote: ... Synthetic human non-biotinylated HEG1 7-mer peptide (residues 1375–1381) was purchased from GenScript. His6-EGFP-KRIT1(WT ...
-
bioRxiv - Cell Biology 2024Quote: MeHA hydrogels were formed from a 3% w/v MeHA macromer solution functionalized with 1 mM RGD peptide (GenScript) in 0.2 M Triethanolamine (TEOA ...
-
bioRxiv - Immunology 2021Quote: ... One million cells per well were added to a U-bottom 96-well plate and were stimulated with 5 μg/ml of pools of overlapping SARS-CoV-2 S protein peptides (GenScript USA Inc, Piscataway, NJ). The stimulation was performed by incubation for 6 h at 37°C and 5% CO2 in the presence of Protein Transport Inhibitor Cocktail (brefeldin A ...
-
bioRxiv - Bioengineering 2021Quote: Purified RfxCas13d proteins and synthetic crRNAs were mixed (unless otherwise indicated) at 2:1 molar ratio in Buffer 1 (GenScript SC1841) or Buffer 22 (25mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then incubated overnight at 4 °C with primary antibodies at 1:100 dilution in PBST and 1 % BSA [SARS-COV-2 Spike S1 antibody (#HC2001 GenScript - #A02038), p62 antibody (#BD 610832) ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 and 6 wt% NorHA hydrogel precursor solutions containing 1 mM thiolated RGD (GCGYGRGDSPG, Genscript) and dithiothreitol (DTT ...
-
bioRxiv - Microbiology 2021Quote: ... the membrane was incubated with 1:7000 polyclonal anti-Bma-LAD-2 peptide antibodies (Genscript) and 1:1000 rabbit anti-β actin antibodies (Abcam ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (GenScript, USA) in carbonate bicarbonate buffer (pH 9.6 ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Biochemistry 2023Quote: ... GII.4 RdRp-NΔ13 and GII.4 RdRp-NΔ51 were also generated by Genscript U.S.A ...
-
bioRxiv - Cell Biology 2023Quote: Western blots were performed using ExpressPlus PAGE Gel 4-12% or 4-20% (GenScript). Proteins were transferred to PVDF membranes (MERCK-Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... Gradient gels (4-12% GenScript) were used in all experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4%-20% (GenScript, M00657) precast gradient gels and transferred to a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-12% gel (GenScript, #M00654) and separated by MOPS buffer (GenScript ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Each 7-mer D-peptide with an N-terminal cysteine was synthesized by GenScript (Piscataway, NJ). Peptides were conjugated with IRDye 800CW maleimide (Li-Cor ...
-
bioRxiv - Cancer Biology 2024Quote: ... Medium was collected 7 days post-transfection and mAbs were purified using protein A resin (Genscript) affinity chromatography and eluted in PBS (pH 7.4) ...
-
bioRxiv - Biochemistry 2022Quote: ... Wells were washed 3 times in PBS and incubated with 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fluorogenic peptide cleavage assays were performed at 37 ° C with 1 μM coreAFG3L2WB or its variants and 50 uM peptide (Leu-(3-NO2-Tyr)-Phe-Gly-(Lys-Abz)) (GenScript) in a 384-well black plate using SpectraMax M5 plate reader (ex = 320 nm ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-Akr1B-2 at 1:100,000 (produced to full-length Drosophila p23 (Q9VH95) by GenScript) and mouse anti-α-Tubulin at 1:5000 (AB_477593 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transferred membranes were incubated with the following primary antibodies overnight at 4°C: DUXBL (1:1000, Custom antibody, GenScript), ZSCAN4C (1:500 ...
-
bioRxiv - Immunology 2023Quote: ... were coated with 1 μg/mL (for IgG) or 5 μg/mL (for IgA) S-2P protein (GenScript), corresponding to the spike protein of the Wuhan-Hu-1 virus stabilized with 2 proline mutations ...
-
bioRxiv - Bioengineering 2020Quote: ... was synthesized as gBlocks Gene Fragment from Integrated DNA Technologies Inc. The ATR2 gene (codon optimized for E. coli) was synthesized from GenScript. All strains and plasmids used in this study are listed in Table 1 and 2 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Mpro inhibition assay was performed using the FRET-based fluorescent peptide substrate DABCYL-KTSAVLQ↓SGFRKM-E(EDANS)-NH2 (purchased from Genscript). The assay was standardized with enzyme concentration of 140 nM and 30 µM of fluorescent substrate in Mpro assay buffer containing (20 mM Tris pH 7.3 ...
-
bioRxiv - Biochemistry 2023Quote: ... encoding multidomain protein TwCel5-6 has an accession number WAK85940.1 (codon optimized for E. coli expression using the OptimumGene™ PSO algorithm) was synthesized by GenScript Biotech (Piscataway ...
-
bioRxiv - Microbiology 2021Quote: ... N501Y.V1 (Variant 1) mutant Spike proteins of SARS-CoV-2 were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse Meis2 isoform D (4) (the tag was removed) and Lhx6 variant 1 (C-DYK) expressing vectors were purchased from Genscript, Dlx5 and Pbx1 coding sequences were amplified from mouse cDNA and cloned into pcDNA3.1 (Genscript) ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Cell Biology 2021Quote: ... (5) was synthesized by GenScript and subsequently subcloned into the respective restriction sites of pcDNA4/TO-CLC7-Y715C ...