Labshake search
Citations for GenScript :
101 - 150 of 1096 citations for 4 Bromo 3' 1 3 dioxolan 2 yl 2 fluorobenzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: WT-CCNE1-3xFLAG (GenScript, Lot:U8948FB050-2/PD40693), N112C-CCNE1-3xFLAG (GenScript ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μL of 800 nM LwaCas13a (Genscript), 1 μL of a 1.6 μM target-specific Cas13 crRNA ...
-
CRISPR-based environmental biosurveillance assisted via artificial intelligence design of guide-RNAsbioRxiv - Molecular Biology 2024Quote: ... 2 µL of 500 nM LwaCas13a (GenScript, #Z03486 ...
-
bioRxiv - Bioengineering 2024Quote: ... and KCGPQGIWGQCK (MMP-2 degradable peptide; GenScript) were used as crosslinkers in a 70:30 molar ratio respectively and were dissolved in 15 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP ...
-
bioRxiv - Microbiology 2021Quote: ... the membrane was incubated with 1:7000 polyclonal anti-Bma-LAD-2 peptide antibodies (Genscript) and 1:1000 rabbit anti-β actin antibodies (Abcam ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (GenScript, USA) in carbonate bicarbonate buffer (pH 9.6 ...
-
bioRxiv - Molecular Biology 2024Quote: ... mouse anti-Strep-tag (IBA, 2-1507-001, 1:1,000) rabbit anti-CBP-tag (GenScript, A00635-40, 1:1,000), mouse anti-V5-tag (Proteintech Group ...
-
bioRxiv - Genetics 2022Quote: The designed 3 pegRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: The 50-residue synthetic peptide used in Figure 3 was synthesized by GenScript USA Inc ...
-
bioRxiv - Genetics 2024Quote: ... 3’ sequence: GTT TTA GAG CTA GAA ATA GCA AGT TAA AAT) (Genscript), amplified with outside primers corresponding to the 5’ constant sequence and the reverse complement of the 3’ constant sequence in 17 cycles using Phusion Polymerase (New England Biolabs) ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-Akr1B-2 at 1:100,000 (produced to full-length Drosophila p23 (Q9VH95) by GenScript) and mouse anti-α-Tubulin at 1:5000 (AB_477593 ...
-
bioRxiv - Immunology 2020Quote: The SARS-CoV-2 pseudovirus was produced by co-transfection of HEK293T cells with 1:1 ratio of DNA plasmid encoding SARS-CoV-2 S protein (GenScript) and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent ...
-
bioRxiv - Immunology 2023Quote: Genes coding for SARS-CoV-2 Spike (S) ectodomains (Hu-1 and BA.1) with Hisx8 and Strep tags were synthesized by Genscript and cloned into the pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2024Quote: The sequence encoding the NSP3 ubiquitin-like domain 1 (Ubl1, residues 1-110) of SARS-CoV-2 was synthesized by Genscript Biotech and inserted into the pCMV-3Tag-3A plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 pseudoviruses were purchased from GenScript, and neutralization activity was measured using the HEK-293T-ACE2 cell line with the same procedures as mentioned above.
-
bioRxiv - Biophysics 2020Quote: The CoV-2 3CLpro sequence was synthetized (GenScript) for optimized expression in E ...
-
bioRxiv - Immunology 2020Quote: ... using IgE-SARS-CoV-2 spike plasmid (Genscript) and pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Molecular Biology 2021Quote: ... Purified FMO-2 protein was purchased from GenScript. Purified FMO5 protein ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 fusion peptide was synthesized (GenScript).
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 Spike RBD protein (GenScript #Z03479) was immobilized on high-absorbency 96-well plates at 5 ng/mL and incubated at 4°C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 5 peptides matching inoculum sequences for both the WT and SS14-DCKO strains (Table 3, labelled with a superscripted “1”) were produced by Genscript (Piscataway, NJ). Upon reception ...
-
bioRxiv - Genetics 2023Quote: ... every 1 μg RNA solution was ligated with 3 μl 25-μM poly(A)-ssRNA adaptor (pAGCUAAAAAAAAAAAAp, synthesized by GenScript Biotech Co.) at 16 °C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... V165A & R166A)50 and NL4.3(Δ: Δ(105 − 278)&Δ(301 − 332))44 in the HIV-1 proviral clone pNL4-3 were performed by GenScript. For use in electron microscopy ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Neutralizing antibodies against the SARS-CoV-2 in hamster blood plasma were determined using the “SARS-CoV-2 Surrogate Virus Neutralization test kit” (GenScript, USA).
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-GCGUCGCAGGCCUUUUUAUU-3’; 0.39 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2022Quote: The previously designed 3 gRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... a single dose (3 nmol/g) of peptides TMyc or TT1Ct (> 95% purity; GenScript), solubilized as 2.5 mM solutions in 0.9% NaCl ...
-
bioRxiv - Microbiology 2021Quote: ... N501Y.V1 (Variant 1) mutant Spike proteins of SARS-CoV-2 were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Bioengineering 2021Quote: Purified RfxCas13d proteins and synthetic crRNAs were mixed (unless otherwise indicated) at 2:1 molar ratio in Buffer 1 (GenScript SC1841) or Buffer 22 (25mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then incubated overnight at 4 °C with primary antibodies at 1:100 dilution in PBST and 1 % BSA [SARS-COV-2 Spike S1 antibody (#HC2001 GenScript - #A02038), p62 antibody (#BD 610832) ...
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of pseudovirus infection of cells containing SARS-CoV-2 receptors was performed on serum specimens using two commercially available SARS-CoV-2 LVV-PsN Kit (SC2087A; SC2087L; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of ACE2 binding to SARS-CoV-2-RBD was performed on serum specimens using a commercially available SARS-CoV-2 sVNT Kit (L00847; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... 10-residue SARS-CoV-2 S2 peptide FKEELDKYFK (GenScript) was dissolved in 100% DMSO at 10 mg/mL and then diluted with PBS to 1 mg/mL ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 Nucleocapsid was purchased from Genscript (Z03480). SARS-CoV-1 spike (40634-V08B) ...
-
bioRxiv - Plant Biology 2021Quote: ... flg22 (2 µM; Genscript, Piscataway, Township, New Jersey, USA). All PAMPs were dissolved in 10 mM MgCl2 ...
-
bioRxiv - Microbiology 2022Quote: ... Following the injection of 2 units PreScission Protease (GenScript), the column was sealed and placed on a rotator at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: The anti-LmrC(2) antibody was generated by GenScript USA Inc ...
-
bioRxiv - Immunology 2021Quote: ... using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Immunology 2021Quote: ... using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Neuroscience 2024Quote: ... The mCherry WT- dynamin-2 was constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 surrogate virus neutralization test (GenScript) was used to detect neutralizing antibodies targeting the viral spike (S ...
-
bioRxiv - Immunology 2023Quote: ... 2 µg/mL biotin conjugated Env peptides (GenScript, customized) were added to plates and incubated for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
bioRxiv - Immunology 2022Quote: ... DNA encoding SARS-CoV-2 HexaPro Spike was synthesized (Genscript) and transiently transfected in FreeStyle 293F cells (Thermo Fisher ...
-
bioRxiv - Immunology 2020Quote: ... and 0.6 μg/mL SARS-CoV-2 S-ECD (GenScript). After washes with PBST (SMART-Lifesciences) ...
-
bioRxiv - Physiology 2022Quote: ... The WT dynamin-2 mCherry plasmid were constructed by GenScript Corporation (Nanjing ...