Labshake search
Citations for GenScript :
101 - 150 of 554 citations for 4 Tert Butyldimethylsilyl Oxy Methyl 2 Iodothiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 (D614) and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of pseudovirus infection of cells containing SARS-CoV-2 receptors was performed on serum specimens using two commercially available SARS-CoV-2 LVV-PsN Kit (SC2087A; SC2087L; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of ACE2 binding to SARS-CoV-2-RBD was performed on serum specimens using a commercially available SARS-CoV-2 sVNT Kit (L00847; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... 10-residue SARS-CoV-2 S2 peptide FKEELDKYFK (GenScript) was dissolved in 100% DMSO at 10 mg/mL and then diluted with PBS to 1 mg/mL ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 Nucleocapsid was purchased from Genscript (Z03480). SARS-CoV-1 spike (40634-V08B) ...
-
bioRxiv - Plant Biology 2021Quote: ... flg22 (2 µM; Genscript, Piscataway, Township, New Jersey, USA). All PAMPs were dissolved in 10 mM MgCl2 ...
-
bioRxiv - Microbiology 2022Quote: ... Following the injection of 2 units PreScission Protease (GenScript), the column was sealed and placed on a rotator at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: The anti-LmrC(2) antibody was generated by GenScript USA Inc ...
-
bioRxiv - Immunology 2021Quote: ... using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Immunology 2021Quote: ... using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 surrogate virus neutralization test (GenScript) was used to detect neutralizing antibodies targeting the viral spike (S ...
-
bioRxiv - Neuroscience 2024Quote: ... The mCherry WT- dynamin-2 was constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Immunology 2023Quote: ... 2 µg/mL biotin conjugated Env peptides (GenScript, customized) were added to plates and incubated for 1 hour at RT ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Evolutionary Biology 2020Quote: The gene encoding 4-hydroxybutyryl-CoA dehydratase (4HBD; Nmar_207) was purchased from Genscript Biotech (codon-optimized with cleavable N-terminal hexa-Histidine tag) ...
-
bioRxiv - Biochemistry 2020Quote: ... SDS-PAGE analysis was performed on precast 4-20% gradient gels (GenScript, USA) in a Tris-MOPS buffered system under reducing conditions according to manufacturer guidelines ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were separated on a 4-12% ExpressPlus™ PAGE gel (GenScript #M41212) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The extracts were fractionated on a 4-20% ExpressPlus™ PAGE gel (Genscript) using SDS-MOPS buffer and transferred onto nitrocellulose membrane (BioTrace™ NT Nitrocellulose transfer membrane ...
-
bioRxiv - Biochemistry 2024Quote: ... The reaction mixture was resolved on a 4-20% Bis-Tris gel (Genscript) and visualized by Coomassie staining.
-
bioRxiv - Biochemistry 2023Quote: ... The pre-cast gradient gels (4-20 %) were purchased from GenScript (Piscataway, NJ). Electrophoresis was performed using a Bio-Rad SDS-PAGE gel analysis casting system (Bio-Rad Laboratories ...
-
bioRxiv - Genetics 2024Quote: ... Extract aliquots were resolved on precast ExpressPlus 4-12% gradient gel (GenScript #M41212), transferred to a nitrocellulose membrane ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were probed overnight at 4°C for SEOV N protein (custom, Genscript) at dilution 1:400 in 1xPBS and with secondary antibody AlexaFluor 555 goat α mouse (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were probed overnight at 4°C for SEOV N protein (custom, Genscript) at dilution 1:400 in 1xPBS and with secondary antibody AlexaFluor 555 goat α mouse (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2024Quote: ... ∼0.25 µg protein were analyzed by SDS-PAGE (SurePAGE 4-12% gels, Genscript cat ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and 2 mL Protein A slurry (1 mL resin, GenScript) was deposited in the columns ...
-
bioRxiv - Immunology 2022Quote: ... DNA encoding SARS-CoV-2 HexaPro Spike was synthesized (Genscript) and transiently transfected in FreeStyle 293F cells (Thermo Fisher ...
-
bioRxiv - Immunology 2020Quote: ... and 0.6 μg/mL SARS-CoV-2 S-ECD (GenScript). After washes with PBST (SMART-Lifesciences) ...
-
bioRxiv - Physiology 2022Quote: ... The WT dynamin-2 mCherry plasmid were constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Immunology 2023Quote: ... plus 10 ng/mL of mouse IL-2 (Z02764, Genscript) in 2 mL complete RPMI1640 medium for 72 h.
-
bioRxiv - Biophysics 2021Quote: ... The samples were then loaded onto a SurePAGE gel (4-20% Bis-Tris)(Genscript). Substrate protein bands were detected by Coomassie Blue staining.
-
bioRxiv - Biochemistry 2020Quote: ... The reaction mixture was directly loaded on the 4-20% SDS-PAGE gel (GenScript) following addition of 4× laemmli loading buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... Whole worm lysates were then separated on 4-12% polyacrylamide gradient gels (GenScript, #M00654), transferred to membranes ...
-
bioRxiv - Cell Biology 2024Quote: pcDNA3.1 vectors expressing human caspase-4 and human IL-18 were purchased from Genscript. Mutagenesis primers were designed using Aligent Quik change primer design ...
-
bioRxiv - Cell Biology 2024Quote: ... the reaction products were loaded onto 4∼20% SDS-PAGE gels (GenScript Biotech, China), and then the signals were obtained by western blotting.
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Plant Biology 2022Quote: Proteins were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and 4%-20% Precast Protein Plus Gel (Yeasen ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were visualized by SDS-PAGE (4-20% gradient gel, Sure Page Gels, GenScript), and band intensity was determined using Image Lab (Bio-Rad) ...
-
bioRxiv - Microbiology 2024Quote: ... tissues were labeled with anti-NP-1 antibody (GenScript U864YFA140-4/CB2093 NP-1). Briefly ...
-
bioRxiv - Plant Biology 2024Quote: WT or mutated lysine 4 trimethylated H3 (1-20aa) peptides were synthesized by GenScript Biotech Corporation ...
-
bioRxiv - Biochemistry 2024Quote: Protein samples were resolved on precast SurePAGE Bis-Tris 4-20% gradient gels (GenScript) or 16% Tris-Glycine gels (Invitrogen ...
-
bioRxiv - Bioengineering 2024Quote: ... SDS-PAGE analyses were performed using 4-12% SurePAGE precast mini polyacrylamide gels (Genscript), and gel images were captured using the FUSION FX7 Spectra multispectral imaging system (Vilber).
-
bioRxiv - Genetics 2024Quote: ... samples were boiled then run on Surepage 4-12% Bis-Tris gels (#M00653, GenScript). Samples were then transferred onto 0.45 um nitrocellulose membranes in Tris-Glycine transfer buffer (25 mM Tris ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Microbiology 2021Quote: ... polyclonal anti-Bma-LAD-2 peptide antibodies were generated by Genscript. Rabbits were immunized with Bma-LAD-2 peptide sequences conjugated to keyhole limpet hemocyanin (KLH) ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding SARS-CoV-2 and other coronavirus S-2P (Genscript) were transiently transfected in FreeStyle 293-F cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Codon-optimized spike of SARS-CoV-2 was purchased from GenScript and subcloned to pcDNA3.1 ...
-
bioRxiv - Immunology 2021Quote: ... SARS CoV-2 Nucleocapsid human chimeric mAb (GenScript, Cat # A02039-100), or in-house antibodies to ORF3a and ORF8 served as positive controls ...