Labshake search
Citations for GenScript :
101 - 150 of 787 citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and either amplified from a clinical isolate (FR-3 and Muc) and cloned into a modified pUC19 backbone (fragments A-D) or de novo synthesized (GenScript) and cloned into a pUC57 backbone (fragments A-C).
-
bioRxiv - Biochemistry 2022Quote: ... middle and bottom of the gradient were collected and 15 μL of each were mixed with 4 μL 4x loading buffer and heated for 3 mins before SDS-PAGE gel electrophoresis (SurePAGE 10% Bis-Tris, GenScript).
-
bioRxiv - Genomics 2022Quote: ... a 9 base pair(bp)’Spatial barcode A’,(3) a 12bp anchor sequence(/AmC6/CTACACGACGCTCTTCCGA-Spatial barcode A-ACTGGCCTGCGA) (Genscript). To enlarge the barcode pool ...
-
bioRxiv - Microbiology 2024Quote: ... plasmid pUC57-KRV-9000-11375 containing part of NS5 gene and the 3’ UTR of KRV (nt 9000-11375) was synthesized by GenScript.
-
bioRxiv - Molecular Biology 2024Quote: ... containing two copies of the 3’ untranslated region (UTR) of the HBB gene and a poly-A sequence of 96 adenines were purchased by Genscript. ABE-SpRY-OPT plasmid was created by inserting the 3’UTR+poly-A fragment in the pCMV-T7-SpRY-P2A-EGFP (RTW4830 ...
-
bioRxiv - Biochemistry 2024Quote: ... non-targeting sgRNA (TGCTTTACCGCGTTGGGTAA) or CLYBL targeting sgRNA (exon 2: CATAGAGCACTGCTCTCCGG; exon 3: AGACTTTGACCTGGGCACAA; exon 4: CCATTGCAGTCTCCACAAAG) were purchased from Genscript. Plasmids were transformed into OneShot™ E ...
-
bioRxiv - Bioengineering 2024Quote: ... Modified synthetic sgRNAs (2’-O-methyl-3’phosphorothioate linkage modifications in the first and last three nucleotides) were purchased from Genscript. sgRNA concentration was calculated using the full-length product reporting method ...
-
bioRxiv - Bioengineering 2024Quote: ... NorHA-CDHA hydrogels (3 wt% NorHA-CDHA) were fabricated by first mixing CDHA with a thiolated adamantane peptide (GCKKK-adamantane, Genscript) (1.2:1 molar ratio of Ad:CD ...
-
bioRxiv - Immunology 2020Quote: ... derived from a peptide scan [15-mers with 11 amino acid overlap] through Spike glycoprotein of SARS-CoV-2) (JPT, Cat: PM-WCPV-5 or GenScript, Cat: RP30020). Phorbol Myristate Acetate (PMA ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... with a unique 5′fluorescent reporter dye (FAM) and 3 fluorescent quencher dye (TAMRA) were designed using mouse mitochondrial genome sequences and synthesized by Genscript (Piscataway, NJ). For absolute quantification using qPCR ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster U6:3 UTR that was amplified with primers 1045.C13 and 1045.C14 from a gene synthesized vector (GenScript, Piscataway, NJ) was cloned using EA cloning ...
-
bioRxiv - Immunology 2024Quote: ... M2 ORF of Ca/04 and 83 nucleotides of the 3’ end of the PB1 gene (40 nucleotides encoding the C-terminus of PB1 ORF and 43 from the 3’UTR region) was synthesized by Genscript (Piscataway, NJ). The fragments were digested with BsmBI ...
-
bioRxiv - Bioengineering 2023Quote: ... A DNA fragment for a floxed transcription stop transcription site (3 copies of SV40 late poly A sequence) followed by a H2B protein fused to mPlum was synthesized by Genscript (Piscataway, NJ) and inserted into pUC57-Kanamycin plasmid ...
-
bioRxiv - Microbiology 2024Quote: ... binding sites of bta-miRNA-16a within the 3’UTR of the bovine Furin were synthesized by a commercial provider (GenScript USA Inc). Briefly ...
-
bioRxiv - Immunology 2022Quote: ... Omicron BA.1 and BA.5 was performed by GenScript, Nanjing ...
-
bioRxiv - Biochemistry 2023Quote: A 27 amino acid peptide containing amino acids 340-366 of RAD18 was purchased from GenScript and used at 200 µM for ITC binding experiments ...
-
bioRxiv - Immunology 2024Quote: ... – BMDC of Pink1−/− mice were stained with Tag-it Violet as described previously and then coated on ice for 3 hours with the mitochondrial peptide pool (custom synthesis by Genscript or Canada Peptide) or mock pool (OVA 257-264 ...
-
bioRxiv - Plant Biology 2024Quote: A plasmid encoding CAMTA2-NT (amino acids 1-364) driven by the SP6 promoter was synthesized (GenScript) and 4μg of plasmid expressed in the TnT Wheat Germ Extract Kit (Thermo ...
-
bioRxiv - Immunology 2021Quote: ... All other peptides were 13 amino acids overlapping by 11 amino acids and were synthesized by GenScript. The peptides covering the envelope (E) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pL7-PfSMC3-3HA-glmS plasmid also contained the homology repair construct 5’- AGATAGAGAGAGTTATATATCTAAAGGAACAAAGAATGAGGCCTACGAAATTATTAGC ATTGTATAAAAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAAAGATTATATATATAAT ATATGTTGACAATTAATAAATATATTTGTATATATCTGTTAACTAATTATGAAAATTTTT GAATCAATAAATTTTTTAAATAACAAAAAAAAAAAAAAATATATATATTATATATATA TTTTATATTTTATATTTTCTTGTAATTTTTGTTTTTTTAGGAGGAAAAACATGCCCTAGA AAATggcggtggaTACCCTTACGATGTGCCTGATTACGCGTAtCCcTAtGAcGTaCCaGAcTAtG CGTACCCtTAtGAcGTtCCgGATTAtGCtcacggggtgTAAGCGGCCGCGGTCTTGTTCTTATTTT CTCAATAGGAAAAGAAGACGGGATTATTGCTTTACCTATAATTATAGCGCCCGAACTA AGCGCCCGGAAAAAGGCTTAGTTGACGAGGATGGAGGTTATCGAATTTTCGGCGGATG CCTCCCGGCTGAGTGTGCAGATCACAGCCGTAAGGATTTCTTCAAACCAAGGGGGTGA CTCCTTGAACAAAGAGAAATCACATGATCTTCCAAAAAACATGTAGGAGGGGACAACA ATTTGGTTTTGTTTTTTTCTTTAGGTTTTGAGAAAAACAAATAGGAAATACAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTATTTTTACATATGCACTTGGATTA TTTTATTTTTATTATTTTTCTTTATATAAAGTAAAAATATACATAAGTATGCTTATTTATT ACATAAGAGTTTATTTAAGAAAGGTTTCTTTTTCATAATATTGTGTGCATGAGTTTTTTT TTATTTTATTTTTTTTTTTTATTTCTGTAACGAAAAGGATATTAAAAAAAATAATAAAA- 3’ (synthesized by GenScript Biotech [Piscataway, NJ, USA]). This homology repair construct comprises a 3 x Hemaglutinin (3HA ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by removal of trifluoroacetic acid (Genscript). When 100 μM of (PR)12 peptide and 0.5 mg/ml of poly-rA RNA were mixed ...
-
bioRxiv - Biophysics 2020Quote: ... or a SARS-CoV (amino acid residues 1 to 1193) (GenBank: AAS00003.1) were synthesized using -optimized codons for Cricetulus griseus (CHO Cell) by GenScript. The cDNAs were subcloned into pTRIMER expression vector (GenHunter ...
-
bioRxiv - Immunology 2020Quote: ... protein (amino acid residues 1 to 1211) (GenBank: MN908947.3) was gene-synthesized using Cricetulus griseus (Chinese hamster)-preferred codons by GenScript. The cDNA was subcloned into pTRIMER expression vector (GenHunter Corporation ...
-
bioRxiv - Immunology 2022Quote: Synthetic peptides (>75% purity by HPLC; 15 amino acids in length overlapping by 11 amino acids) were synthesized by GenScript. To measure T cell responses to the full-length WA-1 S glycoprotein (YP_009724390.1) ...
-
bioRxiv - Immunology 2024Quote: ... custom 15mer OLPs with 11 amino acid overlap were generated spanning the SARS-CoV-2 Spike RBD WH-01 protein (amino acids R319-S591, GenScript). WH-01 peptides that contained VOC mutation loci were substituted with the corresponding mutant sequences when applicable ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibodies used were, anti-p-Smurf2Thr249 (#J1683BA260-5, 1:2000) (GenScript), anti-Phospho-Smad2 (Ser465/467 ...
-
bioRxiv - Developmental Biology 2022Quote: Peptide fragments covering amino acids 55-66 (Genscript) and His-tagged recombinant extracellular domain of Human PTH1R (Cat ...
-
bioRxiv - Molecular Biology 2020Quote: The EPYC1 full-length gene (encoding amino acids 1-317) and corresponding R/K mutant (EPYC1R64A/K127A/K187A/K248A/R314A) were synthesized by GenScript and cloned between the SacII and HindIII site of the pHue vector48 ...
-
bioRxiv - Biochemistry 2024Quote: ... Human CI-MPR cDNA (amino acids 1-2304) with C-tail HPC4 tag (EDQVDPRLIDGK) codon optimized for CHO expression was ordered from Genscript in pcDNA3.1 plasmid ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lamin-C was overproduced and purified from codon-optimized Lamin-C (amino acid residues 1-152) engineered into pRSF-Duet plasmid (Genscript Inc.). The construct carries a tandem N-terminal Strep-tag ...
-
bioRxiv - Genetics 2021Quote: ... The consensus amino acid sequence was printed by GenScript and subcloned into the pCI-Rho vector (Promega).
-
bioRxiv - Biophysics 2020Quote: The gene corresponding to residues 1-201 of colicin 5 (colE5-T) was synthesized (GenScript) and cloned into pET21(+ ...
-
bioRxiv - Immunology 2024Quote: ... 1% non-essential amino acids and were treated with macrophage colony-stimulating factor (m-MCSF, GenScript, Cat # Z02930-50, 40 ng/ml) for 6-7 days with media change every three days to differentiate bone marrow cells into mouse bone marrow-derived macrophages (BMDMs).
-
bioRxiv - Immunology 2020Quote: ... The fifteen amino acid CIS43 epitope peptide was synthesized (GenScript) and modified to contain a C-terminal gly-gly-gly-cys linker sequence (NPDPNANPNVDPNANGGGC) ...
-
bioRxiv - Immunology 2021Quote: ... the fifteen amino acid L9 epitope peptide was synthesized (GenScript) and modified to contain a C-terminal gly-gly-gly-cys linker sequence (NANPNVDPNANPNVDGGGC ...
-
bioRxiv - Biochemistry 2024Quote: ... PDZbm cargo peptide 5-HT4(a)R-pS-5 (Phosphorylated at Serine -5 position; commercially synthesized from Genscript) was dissolved in 20 mM Hepes (pH 7.5) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by primary staining of cells with rabbit anti-N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... R1R2 peptide66,107 (amino acid sequence: GLNGENQKEPEQGERGEAG-PPLSGLSGNNQGRPSLPGLNGENQKEPEQGERGEAGPP) was manufactured by GenScript ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Microbiology 2020Quote: ... 30-amino acid long peptides (with 15-a.a. overlap) were synthesized (Genscript) covering the conserved C-terminal part of the MERS-S2 ectodomain (residues 869-1,288) ...
-
bioRxiv - Microbiology 2024Quote: A 17 amino acid mature SilCR peptide (DIFKLVIDHISMKARKK) was synthesized by Genscript. After reconstitution ...
-
bioRxiv - Neuroscience 2024Quote: ... where the cysteine at position 29 was replaced by aspartic acid (Genscript). The synthesized constructs were injected into flies and targeted to attP1 or attP2 insertion sites on the second or third chromosomes respectively and the transgenic progeny were balanced either over CyO or TM6C (BestGene) ...
-
bioRxiv - Immunology 2023Quote: ... were coated with 1 μg/mL (for IgG) or 5 μg/mL (for IgA) S-2P protein (GenScript), corresponding to the spike protein of the Wuhan-Hu-1 virus stabilized with 2 proline mutations ...
-
bioRxiv - Cell Biology 2021Quote: ... (5) was synthesized by GenScript and subsequently subcloned into the respective restriction sites of pcDNA4/TO-CLC7-Y715C ...
-
bioRxiv - Microbiology 2024Quote: ... followed by staining of cells with primary rabbit anti-SARS-CoV-2 N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...