Labshake search
Citations for GenScript :
1101 - 1150 of 1324 citations for Mouse Anti HIV 1 p24 Recombinant Antibody clone 183 H12 5C since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of competence specific peptide (1 mg/mL, DLRGVPNPWGWIFGR, synthetized by GenScript) and 1-5 µL of linear double-stranded DNA PCR product were mixed in a microcentrifuge tube ...
-
CRISPR-based environmental biosurveillance assisted via artificial intelligence design of guide-RNAsbioRxiv - Molecular Biology 2024Quote: ... 1 µL of 10 µM reporter (poly-U5 or poly-U15, GenScript, custom), 0.96 µL of 10 µM forward primer (GenScript ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant human ACE2-ECD fused with Flag/His tag was produced in 293T cells and purified with anti-DYKDDDDK G1 Affinity Resin according to the manufacturer’s instructions (GenScript).
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was separated from the insoluble material by ultracentrifugation at 180,000g for 30 min and incubated with 4 mL of Anti-DYKDDDDK G1 resin (Genscript) for 1 hour at 4℃ ...
-
bioRxiv - Biochemistry 2024Quote: ... the cells were spun down at 4000 g for 30 min at 4 °C and GLA protein was purified by batch binding with 2.5 mL of Anti-DYKDDDDK G1 Affinity Resin (L00432, Genscript) in the harvested and 0.8 μm filtered supernatant ...
-
bioRxiv - Biophysics 2024Quote: ... The insoluble fraction was removed by ultracentrifugation at 180,000g for 30 min and the supernatant was then incubated with Anti-DYKDDDDK M1 resin (Genscript) for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sample was clarified by centrifugation at 30,000 rpm for 30 min and the supernatant was then incubated with anti-DYKDDDDK Affinity Beads (GenScript) for 3 h at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was separated from the insoluble material by ultracentrifugation at 180,000g for 30 min and then incubated with the Anti-DYKDDDDK G1 resin (Genscript) for 1 h ...
-
bioRxiv - Bioengineering 2023Quote: ... The supernatant was separated from the insoluble material by ultracentrifugation at 180,000g for 30 min and then incubated with the Anti-DYKDDDDK M2 resin (Genscript) for 1 h ...
-
bioRxiv - Neuroscience 2024Quote: ... Then the slices were incubated overnight at 4°C with rabbit polyclonal anti-AQP4 (GenScript Biotech, Piscataway, NJ, USA) diluted 1:2000 in the blocking buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatant obtained after centrifugation of lysate for 20 min at 10,000 rpm at 4°C was loaded onto anti-DYKDDDDK G1 affinity resin (GenScript) equilibrated with buffer A ...
-
bioRxiv - Immunology 2021Quote: Membrane proteins from OP-treated or untreated JEG-3 or purified FC-tagged full length or truncated domains of CRT were incubated with 20 μg of NCR-Myc fusion proteins at 4° C with rotary agitation for 16 h and then with 100 μl anti-Myc coupled magnetic beads (Genscript) at 4° C with rotary agitation for 4 h ...
-
bioRxiv - Microbiology 2020Quote: ... A total of 17 amino acids predicted by the software to be involved in the interaction between anti-CfaE nanobodies and the N-terminal portion of CfaE were individually by Genscript. The genes were cloned into pMAL-C5x vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... The supernatant was collected by centrifugation at 120,000g for 60 min at 4°C and then incubated with anti-DYKDDDDK Magnetic Beads (Genscript, L00835) for 1 h at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... Supernatant from centrifugation at 12000 rpm for 45 min was applied to 2 mL of Anti-DYKDDDDK G1 Affinity Resin (GenScript) which was washed five times by 5 mL of wash buffer I (25 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Bioengineering 2021Quote: ... Hydrogel precursor solution was prepared by incorporating thiolated RGD peptide (GCGYGRGDSPG, 1 mM, Genscript) to promote integrin-mediated cell adhesion and lithium acylphosphinate (LAP ...
-
O-GlcNAcylation reduces phase separation and aggregation of the EWS N-terminal low complexity regionbioRxiv - Biochemistry 2021Quote: ... residues 1-264 (N-terminal LCR; LCRN) was synthesized by GenScript (Piscataway, NJ, USA) with codon optimization for expression in Escherichia coli ...
-
bioRxiv - Neuroscience 2022Quote: ... we inserted the designed sgRNA to target exon-1 of Ezrin (TGGCTGGTTGGTGGCTCTGCGTGGGT) (Genscript: NM_001271663.1_T3). Finally ...
-
bioRxiv - Immunology 2020Quote: HLA-A*0201-restricted MART-1 peptide ELAGIGILTV) was synthesized by GenScript (Nanjing, China). Peptide was stored at 10 mg/ml in 100% dimethyl sulfoxide (DMSO ...
-
bioRxiv - Immunology 2020Quote: MART-1 originated peptide ELAGIGILTV (HLA-A*0201) was synthesized by GenScript (Nanjing, China) with a purity of ≥ 99.0% ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Cancer Biology 2022Quote: FITC-CCNL1321-332 peptides (numbering according to Uniprot Q9UK58-1) were purchased from GenScript and FITC-cyclin E377-384 peptides (numbering according to Uniprot P24864-3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequences were split into 1–1.5 kilobase fragments and ordered as GenParts from GenScript. Primers were ordered from QuintaraBio to amplify from the ends of each GenPart ...
-
bioRxiv - Molecular Biology 2022Quote: ... VHL 3KR-14-3-3ζ (1-230) 19KR K49E mutation were synthesized by GenScript Biotech ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Bioengineering 2023Quote: ... Cell adhesion was enabled through the incorporation of 1 mM RGD peptide (GCGTGRGDSPG, Genscript) in all hydrogel groups.
-
bioRxiv - Immunology 2024Quote: ... Cells were then stimulated with 1 μM of test peptides (custom peptide synthesis, GenScript) or control reagents as indicated in each relevant figure legend and costimulatory antibodies anti-CD28 (BD Biosciences ...
-
bioRxiv - Plant Biology 2024Quote: WT or mutated lysine 4 trimethylated H3 (1-20aa) peptides were synthesized by GenScript Biotech Corporation ...
-
bioRxiv - Immunology 2024Quote: ... Serum samples were diluted (1:10) and preincubated with 100 ng/ml RBDmFc (Genscript) in blocking buffer for 1 hour at room temperature ...
-
bioRxiv - Biochemistry 2024Quote: ... and eluted by W1 buffer supplemented with 250 μg ml-1 Flag peptide (Genscript). The eluent was concentrated and further purified by size-exclusion chromatography (Superose-6 Increase 10/300 column ...
-
bioRxiv - Microbiology 2020Quote: ... samples were added in duplicate (100μl/well) followed by the addition of the anti-human IgG-Fc-HRP (GenScript No. A01854) conjugate (diluted 1:10,000 ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was cleared by centrifugation at 20,000 × g for 35 mins and loaded onto a gravity-flow column to incubate with anti-FLAG affinity resin (GenScript Biotech). The resin was washed with 15 column volumes of Wash Buffer containing 20 mM of HEPES (pH 7.4) ...
-
bioRxiv - Immunology 2023Quote: ... Raw values were normalized to a synthetic standard on each plate (VHH72-Fc by NRC for spike/RBD or an anti-N IgG from Genscript, #A02039). The relative ratios were further converted to BAU/mL using the WHO International Standard 20/136 as a calibrant (33 ...
-
bioRxiv - Molecular Biology 2020Quote: HCoV-19 S gene (virus isolate: Wuhan Hu-1; GenBank number QHD43416.1) was synthesized (Genscript) with codons optimized for insect cell expression ...
-
bioRxiv - Bioengineering 2021Quote: The 14 designs chosen for experimental tests from PIP version 1 were ordered from GenScript pre-cloned into the pET-21a expression vector ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (GenScript, USA) in carbonate bicarbonate buffer (pH 9.6 ...
-
bioRxiv - Microbiology 2021Quote: Microtiter plates (96-well; Thermo) were coated with 1 μg/mL S-2P protein (Genscript) corresponding to the S protein of the Wuhan-Hu-1 virus ...
-
bioRxiv - Biochemistry 2021Quote: ... the codon-optimized WP_011499504.1 ORF was subcloned into pGEX-4T-1-H expression vector (Genscript) to create pGEX4T1_ WP011499504 ...
-
bioRxiv - Biophysics 2020Quote: The gene corresponding to residues 1-201 of colicin 5 (colE5-T) was synthesized (GenScript) and cloned into pET21(+ ...
-
bioRxiv - Immunology 2020Quote: ... N-terminal biotinylated peptides of PyCSP[NXA] listed in Table 1 were obtained from GenScript and used in epitope mapping ELISAs.
-
bioRxiv - Molecular Biology 2022Quote: ... coli optimized coding sequence for human FMRP (isoform 1) was designed and synthesized by Genscript, and then subcloned into pET His6 MBP TEV LIC cloning vector (1M) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and TTK genes were introduced in PANC-1 using pcDNA3.1+/C-(K)-DYK (GenEZ; GenScript) vectors (10 µg/ml) ...
-
bioRxiv - Molecular Biology 2022Quote: We purchased the full-length human LRRK1 gene from Genscript (residues 1-2015, uniprot Q38SD2), codon optimized for Homo sapiens ...
-
bioRxiv - Physiology 2023Quote: ... Tyrosine-substituted (Y134A) and N-terminal (1-96 aa) truncated mutants were purchased from GenScript Biotech (Piscataway ...
-
bioRxiv - Biochemistry 2024Quote: ... and competence was induced by adding 500 ng/mL competence-stimulating peptide (CSP-1; GenScript). After 15 min incubation ...
-
bioRxiv - Biophysics 2024Quote: ... coli and cloned into the 5’BamHI and 3’XhoI sites of pGEX6P-1 (GenScript).
-
bioRxiv - Immunology 2020Quote: ... The protein purity and molecular weight were determined by standard SDS-PAGE along with Western blot confirmation using a Rabbit anti-GST pAb (GenScript, Cat.No. A00097). Recombinant GST-IdeZ was stored in 50 mM Tris-HCl ...
-
bioRxiv - Immunology 2023Quote: ... Insoluble material was removed by centrifugation at 30,000 × g for 30 min and the supernatant was incubated with anti-FLAG affinity resin (GenScript Biotech, Piscataway, NJ). After that ...
-
bioRxiv - Cell Biology 2022Quote: Anti-PCDH15 (HL5614) was generated in rabbit and obtained from Zubair Ahmed and anti-CDH23 was generated in goat by GenScript (Piscataway, NJ) against mouse CDH23 EC15/16 (CATRPAPPDRERQ ...
-
bioRxiv - Biochemistry 2021Quote: ... and 1 mM DTT and incubated with magnetic glutathione beads (L00327; GenScript Biotech, Piscataway, NJ, USA) loaded with recombinant GST-tagged AF1521 for 2 to 4 hours at 4°C with rotation ...