Labshake search
Citations for GenScript :
1101 - 1150 of 1307 citations for B TFIID TATA Box Binding Protein Associated Factor 1 BTAF1 Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... 1 μg of the industrial grade CytERM-GFPxm163-pcDNA3.1(+) plasmid (Genscript), 1.5 μL of Lipofectamine 3000 ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Genomics 2024Quote: ... and shRNA oligos for insertion (Table 1) were synthesized by GenScript. Oligos were reconstituted in water at a concentration of 100 μM ...
-
bioRxiv - Biochemistry 2023Quote: ... His-ERK was further purified using 1 mL glutathione resin (GenScript) to remove any residual GST-tagged MKK1.
-
bioRxiv - Microbiology 2023Quote: ... affinity-purified rabbit polyclonal (peptide SSTEPASTGTPSSGC, produced by GenScript, 1:1000), followed by donkey anti-rabbit Alexafluor555 (Invitrogen A31572 ...
-
bioRxiv - Neuroscience 2020Quote: ... In white clear bottom 96-well plates 10 μL IL-34 antibody (mouse monoclonal IgG2A (v1.1 manufactured by Genscript, Ma et al., 2012), rat monoclonal IgG2A (MAB5195 ...
-
bioRxiv - Microbiology 2021Quote: ... cell cultures were stained with a custom-generated rabbit polyclonal antibody directed against the NP of the prototypic D/bovine/Oklahoma/660/2013 strain (Genscript, Piscataway, NJ, USA) [18] ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 1 μg of POR-WT and mutant membrane proteins were separated on an SDS-PAGE gel and blotted on to polyvinyl difluoride (PVDF) membranes to probe with a rabbit polyclonal antibody against wild-type human POR from Genscript (Genscript, NJ, USA) as described previously [43] ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Molecular Biology 2023Quote: Serum samples were tested for presence of antibodies against SARS-CoV-2 with the L00847 surrogate virus neutralization test (sVNT) (GenScript cPass™, USA) as described in Mariën et al ...
-
bioRxiv - Immunology 2023Quote: ... was used as a capture antibody and rabbit polyclonal antibody raised against IL-7Rγ peptide agonist followed by a mouse anti-rabbit IgG Fc HRP (Genscript Cat# A01856-200) as a detection antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... in the middle of exon 2 was conjugated to KLH to improve antigenicity of the peptide sequence followed by polyclonal antibody production in rabbits (Genscript, Inc. Piscataway, NJ, USA). Anti-Bdwf antibody was affinity purified against the antigenic peptide and specificity was confirmed by immunohistochemistry analyses.
-
bioRxiv - Plant Biology 2020Quote: ... and probed with HRP-conjugated mouse anti-rabbit (1:10,000, Genscript, #A01856) and horse anti-mouse (1:5000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Antagonist peptide 1 (SCSLFTCQNGIV) and 2 (SCSLFTCQNGGGWF) were chemically synthesized by Genscript. Anti-Mouse-IgG (H&L ...
-
bioRxiv - Molecular Biology 2020Quote: The E2-Crimson-human HSD11B1 gene (variant 1) was synthesised by GenScript in vector pUC57 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Tartan (Rabbit, 1:100, This study, GenScript, based on Full-length peptide). Donkey and Goat secondary antibodies conjugated to AlexaFluor488 ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were incubated with 1:200 rabbit anti-S tag (Genscript A00625) overnight and 1:1000 mouse anti GFP (Thermo Fisher A-11120 ...
-
bioRxiv - Microbiology 2019Quote: ... A codon-optimized version of RVB Bang117 NSP1-1 was synthesized (Genscript) and cloned into pLIC8 and pLIC6 using ligation-independent cloning following PCR amplification with appropriate primers and T4 DNA polymerase treatment ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by secondary Goat Anti-Mouse IgG [HRP] (1:3000; A00160, Genscript). Proteins were detected with SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... α-actinin-1 and myotilin derived peptides were obtained from Genscript (USA). For immunofluorescence imaging we used goat anti-human VPS35 (Abcam ...
-
bioRxiv - Molecular Biology 2022Quote: ... pGEX4T-1-SUMO1-3 was designed by AJG and made by GenScript by cloning SUMO1-3 cDNA into BamHI and EcoR1 restriction sites ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 µM DrkBiT peptide (VSGWALFKKIS, synthesized by GenScript at >95% purity) was then prepared and added to wells in triplicate on four white 96-well plates (Greiner Bio-One) ...
-
bioRxiv - Physiology 2023Quote: ... VSMCs were treated with either 1 ng/ml human TNFα (GenScript, Z00100) or 2.4 mM inorganic phosphate in the absence or presence of 0.1μM GSK2656157 (Cayman ...
-
bioRxiv - Biochemistry 2023Quote: ... gene blocks containing A5 fused with alternative purification tags (Genscript; Table 1) were inserted via standard cloning techniques and digested with NcoI and NotI (NEB ...
-
bioRxiv - Neuroscience 2023Quote: The spike peptides (Table 1) were custom ordered and synthesized by Genscript, Netherlands as previously described in Nyström et al 2022 (20) ...
-
bioRxiv - Microbiology 2024Quote: ... anti-EBV BALF0/1 rabbit mAb (generated by Genscript for this study), anti-EBV ZEBRA Mouse mAb (BZ1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pET-28a-6xHis-TEV-3xFLAG-ATP6V1H(1-351) was purchased commercially (GenScript). pFBDM-ATG7-ATG10-ATG12-StrepII2x-ATG5-ATG16L1 and pFDM-SH-SUMO*-Hrr25 were described previously (Schreiber et al. ...
-
bioRxiv - Pathology 2021Quote: ... Samples were mixed by vortexing and tested using the GenScript cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript USA, Inc. Piscataway, NJ, USA) according to the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2020Quote: vash-1 full length cDNA (EMSEMBL ENSDART00000143819.3) was designed and synthesised by GenScript. TA overhangs were added by incubating the insert for 10 min at 72 °C with 50mM DNTPs and Taq polymerase (NEB) ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... hTRPV5 E288DF292LS298T (IS-1) and human TRPV6 (hTRPV6) WT] were obtained from GenScript Corporation (Nanjing ...
-
bioRxiv - Microbiology 2019Quote: ... and 1 µg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Genetics 2022Quote: ... rabbit anti-OLLAS tag pre-absorbed against untagged animals 1:150 (Genscript, #A01658), mouse anti-FLAG pre-absorbed against untagged animals 1:400 (Sigma, ...
-
bioRxiv - Microbiology 2022Quote: ... A total of 120 peptides (Table 1) were produced by Genscript (Piscataway, NJ). Upon receipt ...
-
bioRxiv - Physiology 2021Quote: The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Immunology 2022Quote: ... then 3.5μL of 1 mg/ml normal mouse IgG (mIgG) (GenScript, Cat# A01007) was added ...
-
bioRxiv - Microbiology 2019Quote: ... and 500 μL of tissue culture media containing 500 pM GLP-1 (GenScript) added to the lower chamber ...
-
bioRxiv - Immunology 2019Quote: ... NY-ESO-1 (157-165; SLLMWITQV) peptide was purchased at >95% purity (GenScript). Purified peptide-HLA-A*02 was biotinylated in vitro by BirA enzyme (Avidity ...
-
bioRxiv - Physiology 2021Quote: ... PC-1 and PC-2 coiled-coil domain peptides were custom-made (Genscript). PC-1 or PC-2 peptides were added to pipette solution immediately before use at a final concentration of 1 μM ...
-
bioRxiv - Microbiology 2022Quote: The SARS-CoV-2 Wuhan-Hu-1 RBD construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Biochemistry 2022Quote: The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the muscle-specific MCK promoter (gift from Jeff Chamberlain) ...
-
bioRxiv - Immunology 2022Quote: His tag-IP was performed using anti-His affinity resin (GenScript L00439-1) and Myc tag-IP was performed using anti-Myc affinity resin ...
-
bioRxiv - Immunology 2023Quote: ... and 1 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... immature BMDCs were harvested and loaded with 1 μg/ml OVA257-264 (GenScript), B16-OVA-Ogt+/+ and B16-OVA-Ogt−/− cells supernatant at 37°C for 6 h ...
-
bioRxiv - Immunology 2019Quote: ... was added to wells either alone or with CGRP (1, 10, 100 nM, GenScript) and incubated for 72 hr ...
-
bioRxiv - Bioengineering 2021Quote: ... Hydrogel precursor solution was prepared by incorporating thiolated RGD peptide (GCGYGRGDSPG, 1 mM, Genscript) to promote integrin-mediated cell adhesion and lithium acylphosphinate (LAP ...
-
O-GlcNAcylation reduces phase separation and aggregation of the EWS N-terminal low complexity regionbioRxiv - Biochemistry 2021Quote: ... residues 1-264 (N-terminal LCR; LCRN) was synthesized by GenScript (Piscataway, NJ, USA) with codon optimization for expression in Escherichia coli ...
-
bioRxiv - Neuroscience 2022Quote: ... we inserted the designed sgRNA to target exon-1 of Ezrin (TGGCTGGTTGGTGGCTCTGCGTGGGT) (Genscript: NM_001271663.1_T3). Finally ...
-
bioRxiv - Immunology 2020Quote: HLA-A*0201-restricted MART-1 peptide ELAGIGILTV) was synthesized by GenScript (Nanjing, China). Peptide was stored at 10 mg/ml in 100% dimethyl sulfoxide (DMSO ...