Labshake search
Citations for GenScript :
951 - 995 of 995 citations for Recombinant Human GPC3 protein His tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... [32] Protein purity was confirmed by sodium-dodecyl-sulfate polyacrylamide electrophoresis (SDS-PAGE) on 4-15% gradient gels (Genscript, USA) stained with 0.0025% w/v each of Coomassie® Brilliant Blue G-250 and R-250 in 10% v/v ethanol ...
-
bioRxiv - Developmental Biology 2024Quote: The antibodies used in this study were as follows: A custom antibody against ExoA was generated in rabbits using purified full-length protein as the antigen (GenScript). Mouse Polyglycylated-tubulin antibody (1:1000 ...
-
bioRxiv - Immunology 2024Quote: 15-mer peptides with 11 amino acids overlap that cover the full length of S protein of SARS-CoV-2 were synthesized (GenScript). Peptides were dissolved in DMSO at 12 mg/ml and 12-15 peptides were mixed to create 26 different semi-pools ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rosetta synaptobrevin a codon-optimised nucleotide sequence encoding the soluble portion of the protein [Syb (1-75)] was prepared by gene synthesis (Genscript, USA): GAGGCGAACCGTACCGGTGACTACCGTCTGCAGGAAGCGCAGCGTCAAGTGGGCGAAGTT CAAAACGTGATGCGTGATAACCTGACCAAGGTTATCGAGCGTGGTGAAAAACTGGACGATC TGGACGCGAAGGCGGAAGATCTGGAGGCGGAGGGTCAGCGTTTCCAAAACCGTGCGGGCC GTCTGCGTCGTCAGATGTGGTGGCAAAACAAACGTAACCAGTAA
-
bioRxiv - Developmental Biology 2022Quote: ... The protein was eluted using elution buffer (50mM Tris-HCL,7.4, 100mM NaCl, 1mM EGTA, Flag peptide (GenScript, 300 μg/ml). The isolated proteins were then prepared for mass spectrometry using an in-solution protein digestion kit (Thermo Scientific) ...
-
bioRxiv - Pathology 2019Quote: ... The samples were loaded onto a 12% (vol/vol) SDS/PAGE gel and target proteins were detected using a polyclonal anti-GFP antibody (GenScript, USA) or a monoclonal anti-FLAG (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: Purified RfxCas13d proteins and synthetic crRNAs were mixed (unless otherwise indicated) at 2:1 molar ratio in Buffer 1 (GenScript SC1841) or Buffer 22 (25mM Tris pH 7.5 ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...
-
bioRxiv - Microbiology 2020Quote: ... Target proteins were obtained with purity >85% and endotoxin level <2 EU/mg (LAL Endotoxin Assay Kit, GenScript, Cat. No. L00350). In addition ...
-
bioRxiv - Biophysics 2020Quote: ... The identities of purified HA-TIN2S and HA-TIN2L proteins were confirmed by the Western Blot analysis using the HA antibody (GenScript A00168), and MALDI-TOF mass spectrometry analysis (UNC-Chapel Hill Proteomics Center) ...
-
bioRxiv - Cell Biology 2020Quote: ... and for generation of EGFP-C2-Arp3B plasmid, the mRNA transcript variant 1 encoding murine actin-related protein 3B (Actr3b) (Jay et al., 2000) was synthesized (GenScript Biotech) and cloned into pEGFP-C2 vector (Clontech).
-
bioRxiv - Cell Biology 2022Quote: ... 20-50 μg of protein lysate of each sample was loaded and separated on 4-12% Bis-Tris gels (Thermo Fisher or GenScript) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: Sequences encoding the 3CL-pro and RBD proteins were codon optimized for expression in Escherichia coli and cloned into the pET-28a(+) vector (Genscript Biotech). The chimeric protein 3CLpro-RBD was produced by generating a gene construct that linked the 3CL-pro and RBD genes by a bridge sequence that encoded for glycine-proline triple repeat (GPGPGP ...
-
bioRxiv - Microbiology 2021Quote: ... active protein fractions were further separated through sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; 4%–20% Bis-Tris Gel; GenScript, USA). Proteins in the gel slices were eluted in HEPES-K+ buffer (50 mM ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...
-
bioRxiv - Microbiology 2020Quote: ... class C-like β-lactamase protein (gi|919167542) and the Elizabethkingia GOB-13 (AY647250) were synthesized by GenScript (Piscataway, NJ, USA) and optimized for protein expression in Escherichia coli in the pET24a(+ ...
-
bioRxiv - Molecular Biology 2022Quote: Equal sample concentrations (100 μg of total protein per well) were resolved in 4%–20% electrophoresis gradient gels (Genscript, Cat. M00656) and transferred onto polyvinylidene difluoride (PVDF ...
-
bioRxiv - Plant Biology 2022Quote: ... Sequences starting after the residue corresponding to butelase-1-L26 or after the signal peptide predicted using SignalP5.0 were cloned into the pET28a(+) vector at Ndel/Xhol restriction sites to generate a His6-fusion protein construct (Genscript, USA). Point mutations were generated using a Q5 mutagenesis kit (New England Biolabs ...
-
Novel mRNA vaccines encoding Monkeypox virus M1R and A35R protect mice from a lethal virus challengebioRxiv - Immunology 2022Quote: M1R and A35R protein sequences from MPXV strain Zaire79 were used to reversely translate to their coding sequences by GenSmart™ Codon Optimization (GenScript). The A35R extracellular domain was fused with M1R by a peptide linker was also synthesized ...
-
bioRxiv - Microbiology 2023Quote: ... Fusion proteins were generated for the assay by cloning chlamydial DNA sequences encoding CPAF into a pET30a vector (constructed by Genscript Biotech), resulting in fusion proteins with a hexahistidine (His6 ...
-
bioRxiv - Immunology 2024Quote: ... Heat 500 μl of mouse serumat 56℃ and then incubated the heated serum with 1 ml of washed Protein-G resin (GenScript L00209) overnight at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... Cell debris were removed by centrifugation (10,000 x g for 10 min at 4°C) and the supernatant was incubated with 30 μL of protein A/G-coated magnetic beads (Genscript L00277) for 1 hour at 4 °C to remove nonspecifically bound proteins ...
-
bioRxiv - Microbiology 2023Quote: ... Genes encoding pyocin SX1 and SX2 and associated immunity proteins (GenBank records ON716475-ON716476) were codon optimized and synthesized (GenScript, USA) for expression in E ...
-
bioRxiv - Molecular Biology 2023Quote: ... the beads were washed thoroughly with the IP buffer and the bound proteins were eluted with 200 μg/ml Flag (DYKDDDDK) peptide (GenScript, RP10586) in thermomixer at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 ug protein samples were boiled at 90°C for 5 minutes in LDS sample buffer (Genscript#M00676 or Millipore#MPSB) containing 5% 2-mercaptoethanol ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fusion protein MBP-Hyx 1-176 was purified and injected into guinea pigs and the antibodies generated were purified by GenScript (Hong Kong).
-
bioRxiv - Biophysics 2022Quote: ... the coding sequence for the E protein from SARS-CoV-2 was initially codon optimized for Xenopus laevis and synthesized (GenScript, Piscataway, NJ). The gene was later modified for expression in HEK293 cells by adding a fluorescent EGFP tag ...
-
bioRxiv - Plant Biology 2022Quote: ... The membrane was first stained with Ponceau S to show protein loading before blocking and incubation with first antibodies: CHLI antiserum was raised by Genscript (Nanjing, China) and validated in chli mutant and WT (Supplemental Figure S12) ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were heated for 10 min at 100°C and were then loaded on an SDS gradient gel (4–20% Precast Protein Improve Gels, Genscript Biotech Corporation). The gel was run for 120 min at 120 V ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was run on separate 12% SDS–polyacrylamide gel and probed using βarr antibody and HRP-coupled protein L antibody (dilution-1:2,000; GenScript; cat. No. M00098) by western blotting ...
-
bioRxiv - Biochemistry 2020Quote: ... The process of antibody purification was using GenScript Protein A MagBeads according to the manufacturer’s instructions (Catalog No: L00273, GenScript, Piscataway, NJ, USA). Then ...
-
bioRxiv - Immunology 2021Quote: RBD and NP end-point titers were determined using standard ELISA and plates coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) or 1ug/mL SARS-CoV-2 nucleocapsid protein (NP) ...
-
bioRxiv - Immunology 2021Quote: ... resuspended at a density of 15 million/mL in complete RPMI and 100 μL of cell suspension containing 1.5 million cells was added to each well of a 96-well round-bottomed tissue culture plate and stimulated ex vivo with a peptide pool consisting of 15mer peptides overlapping by 11 amino acids spanning the S protein (GenScript, Piscataway, NJ), at a concentration of 1.2 μg/mL of each peptide in the presence of 1 μg/mL anti-CD28 ...
-
bioRxiv - Immunology 2021Quote: RBD end-point titers were determined using standard ELISA and plates were coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) Heat inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... flanking the EVT region (intron is between the N and G residues) and the KLH-conjugated antibody was purified by protein G column (GenScript USA Inc.). Samples were mounted in VECTASHIELD (Vector Laboratories ...
-
bioRxiv - Cell Biology 2024Quote: ... and then subjected to denaturation at 100 °C for 10 min after the addition of 4X protein loading buffer (GenScript Biotech, China). Then ...
-
bioRxiv - Bioengineering 2023Quote: ... A DNA fragment for a floxed transcription stop transcription site (3 copies of SV40 late poly A sequence) followed by a H2B protein fused to mPlum was synthesized by Genscript (Piscataway, NJ) and inserted into pUC57-Kanamycin plasmid ...
-
bioRxiv - Immunology 2022Quote: 15-mer peptides overlapping by 10 amino acids spanning the entire protein sequence of SARS-CoV-2 Spike were synthesized (GenScript; see Table S1). To stimulate whole blood or PBMC ...
-
bioRxiv - Biochemistry 2019Quote: ... Plasmids used to express the linked-BchL-proteins carrying glycine linkers of various lengths were synthesized as codon-optimized genes (Genscript Inc., Piscataway, NJ). The longest iteration of the linked-BchL-protein was generated as described in the supplemental section.
-
bioRxiv - Microbiology 2020Quote: ... glutamicum open reading frames were amplified from genomic DNA by PCR and cloned in pET-28a vector by restriction free cloning 39, while expression constructs for the other proteins (CmE2p, MtE2p, MtE2b) were provided by Genscript (Leiden, the Netherlands). In all cases ...
-
bioRxiv - Immunology 2021Quote: ... The gene encoding the Spike protein of SARS-CoV-2 (UniProt P0DTC2) codon-optimized for expression in CHO cells was synthesized by Genscript (Piscataway, NJ, USA). The optimized DNA fragment was cloned in the expression vector to create pCNeoMEM-S ...
-
bioRxiv - Immunology 2024Quote: ... identical amounts and volumes of protein lysate from either untransfected or transfected cells were added to 20 μl of anti-DYKDDDDK G1 Affinity Resin (GenScript, Cat. No. L00432), previously washed with TBS 0.1% Tween™ 20 (TBS-T) ...
-
bioRxiv - Microbiology 2020Quote: ... The cDNA for SARS-CoV-2 Spike protein ectodomain residues 1 to 1220 (S-Ectodomain-GFP) was chemically synthesized with optimal insect cell codons (Genscript USA Inc, NJ, USA) and cloned into pVL1393 (Expression Systems ...
-
bioRxiv - Immunology 2021Quote: ... One million cells per well were added to a U-bottom 96-well plate and were stimulated with 5 μg/ml of pools of overlapping SARS-CoV-2 S protein peptides (GenScript USA Inc, Piscataway, NJ). The stimulation was performed by incubation for 6 h at 37°C and 5% CO2 in the presence of Protein Transport Inhibitor Cocktail (brefeldin A ...
-
bioRxiv - Biochemistry 2023Quote: ... The gene encoding for the GAF2 domain from All1280 of Nostoc PCC 7120 (NCBI protein ID BAB73237.1, UniProtKB Q8YXD3, amino acids 562-727) was ordered from Genscript (codon optimized for E. coli) in the pUC18 cloning vector ...