Labshake search
Citations for GenScript :
51 - 100 of 905 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... an FBXO3(NM_012175) ORF Clone was purchased from GenScript (Cat. #OHU25332D), and the open reading frame amplified using the primers listed in Supplementary Data ...
-
bioRxiv - Biophysics 2021Quote: ... coli optimized codons for the C0-C2 portion of human cMyBP-C with N-terminal 6x His tag and TEV protease cleavage site were obtained from GenScript (Piscataway, NJ). For TR-FRET binding assays ...
-
bioRxiv - Biochemistry 2020Quote: Full-length wild-type human ASPA cDNA with an N-terminal RGS6xHis-tag was expressed from pcDNA3.1 (Genscript). The C152W variant was generated by Genscript ...
-
bioRxiv - Molecular Biology 2020Quote: Full-length wild-type human FLCN cDNA carrying an N-terminal RGS6xHis-tag was expressed from pcDNA3.1 (Genscript). USP7 was expressed with an N-terminal myc-tag from pcDNA3.1 (Genscript) ...
-
bioRxiv - Developmental Biology 2024Quote: The cDNA open reading frame (ORF) for mouse chemokine (C-C motif) ligand 2 (Ccl2) was ordered from GenScript and subsequently amplified by PCR using PhusionTM High-Fidelity DNA Polymerase & dNTP Mix ...
-
bioRxiv - Cancer Biology 2022Quote: SPTLC1 gene cDNA ORF nucleotide sequence (NM_006415) was purchased from GenScript. The ORF was subjected to point mutation to generate mutant SPTLC1C133W ORF and cloned into pCW57.1 vector (addgene Plasmid #41393) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... expressing N-terminally FLAG-tag (GenScript, Leiden, Netherlands). A selection of truncated versions of the AhR and ARNT was done based on previously published data [27,30] ...
-
bioRxiv - Cancer Biology 2023Quote: ... PLXNB2 OHu01778C_pcDNA3.1(+) N-Terminal Flag-Tag (GenScript #SC1626), PLXNB2 OHu01778D_pcDNA3.1+/C- C-Terminal Flag-Tag (GeneScript #OHu01778D) ...
-
bioRxiv - Neuroscience 2021Quote: ... #E5510S) of the Plppr4 ORF clone (NM_001001508.2) from GenScript (Piscataway, NJ, #SC1200) to introduce an N-terminal 3xHA tag 5’-ACCCATACGATGTTCCAGATTACGCTTACCCATACGATGTTCCAGATTACGCTTACC CATACGATGTTCCAGATTACGCT-3’ ...
-
bioRxiv - Immunology 2021Quote: ... NWSHPQFEK (NWS) tag-159Tb (clone 5A9F9, GenScript), AU1-162Dy (clone AU1 ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag (clone HPC4, Genscript), anti-E tag (clone 10B11 ...
-
bioRxiv - Immunology 2021Quote: ... anti-NWSHPQFEK (NWS) tag (clone 5A9F9, Genscript), anti-Ollas tag (clone L2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A horseradish peroxidase (HRP) labeled secondary against the His tag (Genscript) was added at a 1:5,000 dilution in 3% BSA in TBS-T ...
-
bioRxiv - Biochemistry 2020Quote: ... or N-terminal poly-histidine-tag (Genscript, codon-optimized) was expressed in E ...
-
bioRxiv - Biochemistry 2020Quote: ... or into pcDNA3.1-(+)-N-DYK (nsp2) to append an N-terminal FLAG tag (GenScript).
-
bioRxiv - Microbiology 2020Quote: ... hnRNPUL1 (NM_007040) and PEG10 (NM_015068.3) were PCR amplified from ORF clones (hnRNPL, GenScript #OHu14072 ...
-
bioRxiv - Immunology 2021Quote: ... anti-DYKDDDDK (FLAG) tag-175Lu (clone 5A8E5, GenScript), VSVg tag-158Gd (rabbit pAb ...
-
bioRxiv - Immunology 2021Quote: ... anti-NWSHPQFEK (NWS) tag-159Tb (clone 5A9F9, Genscript), anti-AU1-162Dy (clone AU1 ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag-171Yb (clone HPC4, Genscript), anti-mCherry-142Nd (Abcam) ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag-171Yb (clone HPC4, Genscript), anti-mCherry-142Nd (Abcam) ...
-
bioRxiv - Immunology 2021Quote: ... anti-NWSHPQFEK (NWS) tag-159Tb (clone 5A9F9, Genscript), anti-AU1-162Dy (clone AU1 ...
-
bioRxiv - Microbiology 2020Quote: ... and SARS-CoV-2 spike protein (ECD, His & Flag Tag) (GenScript Z03481). Proteins were biotinylated using EZ-Link™ Sulfo-NHS-Biotin ...
-
bioRxiv - Biochemistry 2023Quote: The genes encoding full-length TcdB toxin variants (TcdB1,3 and 4) were synthesized with a C-terminal His-tag and cloned into pC-His 1622 by Genscript. The pC-His1622 vector was purchased from MoBiTec ...
-
bioRxiv - Neuroscience 2024Quote: ... Full-length cDNA encoding mouse PLCXD2 containing a C-terminal FLAG-tag in pcDNA3.1 (clone OMu06191, NM_001134480.1) was purchased from GenScript. The FLAG-tag was replaced with TdTomato to generate PLCXD2-TdTomato ...
-
bioRxiv - Biophysics 2024Quote: The mPRD2 construct with a C-terminal His-tag was bought from Genscript Inc ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins with a His tag was purified with the Ni-NTA resin (Genscript) according to the product manual ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 ml of anti-His-tag affinity resin (GenScript Biotech, Piscataway, NJ, USA) was added into the concentrated culture medium and incubated at 4 °C overnight with rotation ...
-
bioRxiv - Cell Biology 2022Quote: ... Human HSPE1-GFP was cloned into pcDNA3.1 from the HSPE1 (NM_002157.2) ORF Clone (OHu17870D, Genscript). The HSPE1-GFP constructs were transfected into cells using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Immunology 2022Quote: ... Delta B1.617.2 clone was generated by gene synthesis with a codon-optimized Spike ORF (GenScript). The Omicron ORF was amplified from an RNA as described for protein production with primers listed in Table 3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Peptides containing an N-terminal biotin tag were purchased from GenScript and dissolved according to manufacturer’s recommendation ...
-
bioRxiv - Microbiology 2024Quote: ... using anti-His (mouse) primary antibody (GenScript) at a dilution of 1:3,000 ...
-
bioRxiv - Biochemistry 2023Quote: ... Equilibrated Ni-NTA resin was added to the products to bind the MBP-His tag and the His-tagged TEV protease (Genscript, Cat. # Z03030) while allowing the purified FAM210A-dMTS cleaved product to be collected in the flowthrough ...
-
bioRxiv - Synthetic Biology 2023Quote: The expression levels of his-tagged nanobodies resulting from microfermentations were quantified using the His tag ELISA detection kit (GenScript, Cat# L00436) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... USP7 was expressed with an N-terminal myc-tag from pcDNA3.1 (Genscript). All mutations were generated by Genscript ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse α-His antibody (1:1000, Genscript A00186) in TBST buffer with 0.5% BSA and goat α-mouse IgG (H+L ...
-
bioRxiv - Biochemistry 2021Quote: Mammalian expression plasmid pcDNA3.1+/C-(K)-DYK carrying the ORF sequence of WT CYP21A2 (NM_000500.7) with a C-terminal DYK (FLAG) tag was purchased from GenScript (New Jersey, USA). We used this plasmid as a template to create the variants through site-directed mutagenesis ...
-
bioRxiv - Immunology 2022Quote: ... The Delta B1.617.2 variant clone was generated by gene synthesis with a codon optimized Spike ORF (GenScript). The final constructs encode the Spike ectodomains ...
-
bioRxiv - Molecular Biology 2021Quote: ... mouse anti FLAG-tag (1:500; A00187, GenScript). Anti-rabbit and anti-mouse secondary antibodies coupled to Alexa-488 ...
-
bioRxiv - Biochemistry 2022Quote: ... and mouse anti-HA-tag monoclonal antibody (GenScript). After primary antibody incubation ...
-
bioRxiv - Immunology 2024Quote: ... or mouse mAb specific for HA tag (GenScript). Alexa Fluor™ 488-conjugated Goat anti-Mouse IgG (H+L ...
-
bioRxiv - Biochemistry 2023Quote: ... the expression levels of each mutant series and their wild-type version were normalized for comparison purposes by quantitation via western blots against the 6xHis tags present at the C-termini of all constructs (Antibody: anti-His-Tag Antibody coupled with iFlour 488, Genscript, A01800, 1:500 dilution). Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Molecular Biology 2023Quote: Vectors for expression in mammalian cells of N-terminally 3XFLAG-tagged wild type and mutant forms of human eIF3G were prepared by inserting the appropriate wild type ORF into pcDNA3.1(+)-N-DYK and using the resulting vector for mutagenesis (GenScript).
-
bioRxiv - Immunology 2023Quote: ... The biotinylated SARS-CoV-2 fusion peptide (N’-biotin-DPSKPSKRSFIEDLLFNKVT-C’) and His-tagged HIV Env MPER peptide (N’-NWFDITNWLWYIKSGGSHHHHHHHH-C’) were chemically synthesized by GenScript.
-
bioRxiv - Immunology 2021Quote: ... Western blot and immunoprecipitation and has sensitivity comparable to the THE™ His Tag Antibody (Genscript) in ELISA and Western Blot (Supplementary Fig.S7).
-
bioRxiv - Biophysics 2024Quote: ... both of which contained His tags that could be cleaved by thrombin (GenScript Biotech, Piscataway, NJ). The proteins were expressed and purified from BL21(DE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... XM:006510629.3 ORF sequence) cDNAs cloned into the pcDNA3.1+/C-(k)-DYK vectors were obtained from GenScript. For the electrophysiological recordings of the Na+ currents ...
-
bioRxiv - Plant Biology 2022Quote: ... His-FmASP protein was detected by immunoblotting with using a mouse anti-His antibody (GenScript, A00186). The immunoblotting band signals were visualized by enhanced enhanced chemiluminescence (ECL ...
-
bioRxiv - Cell Biology 2021Quote: cDNA constructs with the indicated epitope tags were synthesized (Genscript, USA) and provided as entry clones ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 1:200 iFluor647-conjugated mouse anti-His (Genscript A01802) for civet ACE2 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the mouse anti-His (A00186, GenScript, 1:5000 diluted), and the rabbit anti-HA (902303 ...