Labshake search
Citations for GenScript :
51 - 100 of 200 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: The TRI2-2 and influenza virus minibinders were cloned into pET29b between the NdeI and XhoI restriction sites by Genscript. The TRI2-2 minibinder was cloned with a C-terminal polyhistidine tag and the influenza minibinder was cloned with an N-terminal polyhistidine tag17 ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...
-
bioRxiv - Molecular Biology 2020Quote: ... vector containing DENV2C protein gene sequence with N-terminal His tag and Tobacco Etch Virus (TEV) digestion site was purchased from GenScript (China). Recombinant capsid protein from DENV2 NGC strain was expressed in Escherichia coli BL21 strain ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...
-
bioRxiv - Microbiology 2024Quote: The viral segments of the human influenza virus A/Texas/37/2024 (H5N1, HPhTX) were synthesized in the genetic background of pUC57 (GenScript, USA). The synthesized sequences were designed according to the published sequences for the clinical HPhTX isolate with GenBank accession numbers PP577940-47 ...
-
bioRxiv - Genetics 2021Quote: ... The predicted full-length lincRNA sequences were amplified by PCR and cloned into the pJR1-41XL vector (Moreno, Durán and Ribas, 2000) using the CloneEZ® PCR Cloning Kit (GenScript). Each plasmid was checked by PCR for correct insert size ...
-
bioRxiv - Developmental Biology 2021Quote: ... The ORF was subcloned into the BamH1 site of pCS2+ (pCS2+-sobp) using the Clone EZ PCR cloning kit (GenScript). pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent) ...
-
bioRxiv - Immunology 2024Quote: ... the Thosea assigna virus (TAV) 2A protease and the mature IGIP was generated with a cloning spacer downstream and acquired from Genscript (Piscataway, NJ). The fragment was digested with AarI (Thermo Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA fragment was then inserted into the KpnI and HindIII digested pLJ-Ssc70-Myc backbone using the CloneEZ™ PCR Cloning Kit (GenScript) to get pLJ-Hsp70-Myc plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: Serum samples were tested for presence of antibodies against SARS-CoV-2 with the L00847 surrogate virus neutralization test (sVNT) (GenScript cPass™, USA) as described in Mariën et al ...
-
bioRxiv - Biophysics 2024Quote: The uniformly isotopically labelled ORF6CTR with sequence SKSLTENKYSQLDEEQPMEID was produced by recombinant protein expression with an N-terminal glutathione S-transferase (GST) tag followed by a tobacco etch virus (TEV) cleavage site in the pGEX-6P-1 expression vector (GenScript Biotech UK Limited, Oxford, UK). ORF6CTR was expressed in Escherichia coli (E ...
-
bioRxiv - Immunology 2021Quote: ... PCR products were Sanger sequenced by GenScript, and sequences were analyzed using IMGT/V-QUEST (32).
-
bioRxiv - Immunology 2020Quote: ... PCR products were Sanger sequenced by Genscript and sequences were analyzed using IMGT/V-QUEST (33) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR products were Sanger sequenced by Genscript.
-
bioRxiv - Microbiology 2022Quote: ... PCR amplifications were performed with Taq DNA Polymerase (GenScript) according to the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2020Quote: ... CCT isoforms were PCR amplified from synthetic vectors from GenScript. SpCas9 was PCR amplified from px4591 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Point mutations were introduced by the PCR CloneEZ method (GenScript). Plasmids were transformed in acrB-deficient MG1655 E ...
-
bioRxiv - Plant Biology 2021Quote: ... The purified PCR amplicons were sequenced using Sanger sequencing (Genscript, NJ). The overlapping PCR amplicon sequences were aligned and comparative analysis with the WT sequences was used to identify mutations for each of the independent nec3 mutants.
-
bioRxiv - Cancer Biology 2024Quote: ... a PCR amplification of the corresponding pre-miR sequences from GenScript plasmids was performed using the specific primers (forward primer ...
-
bioRxiv - Microbiology 2024Quote: ... PCR fragment 1 was amplified from plasmid pUC57-re-ulg8 (GenScript) using primers 5’ box_F and 5’ box_R ...
-
bioRxiv - Microbiology 2024Quote: ... The first PCR fragment represented a 523 bp synthetic sequence (GenScript) corresponding to the 3’ end of the ulg8 gene ...
-
bioRxiv - Microbiology 2022Quote: ... DNA fragments were generated by PCR or DNA synthesis (Genscript, New Jersey) containing ∼500-1000 bp DNA flanking each gene and fused together ...
-
bioRxiv - Microbiology 2020Quote: ... hnRNPUL1 (NM_007040) and PEG10 (NM_015068.3) were PCR amplified from ORF clones (hnRNPL, GenScript #OHu14072 ...
-
bioRxiv - Biophysics 2023Quote: ... FRET-labeled 207 bp DNA was prepared by PCR using labeled primers (GenScript) ATCGGACCC/iCy5N/ATACGCGGCC (forward primer) ...
-
bioRxiv - Biochemistry 2020Quote: ... Templates for sgRNA transcription were generated by PCR amplifying synthesized fragments (IDT and Genscript) or by annealing a T7 primer oligo to a single stranded template oligonucleotide ...
-
bioRxiv - Biochemistry 2024Quote: ... the coding sequences for the PINK1 constructs were PCR amplified using clone OHu25380D (Genscript) as a template and cloned into the vector pFB-6HZB (SGC ...
-
bioRxiv - Biochemistry 2023Quote: ... the PCR amplified sfGFP sequence was first subcloned into vector pUC57 containing synthesized (GenScript) C-terminus for 3C-STREP-KKCKK-GFP11 (pFMP249) ...
-
bioRxiv - Biophysics 2021Quote: ... cyaA DNA was amplified from genomic DNA by PCR and cloned in pET-15b (GenScript) using AsuII and NcoI enzymes to generate plasmid pME14 ...
-
bioRxiv - Plant Biology 2021Quote: ... Primers were designed with Real-time PCR (TaqMan) Primer and Probes Design Tool from GenScript wesite (www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool ...
-
bioRxiv - Bioengineering 2022Quote: ... and gene expression was examined by real-time PCR using primer pairs (Genscript, Nanjing, China) and SYBR Green (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting DNA was used as template for PCR amplification using Taq DNA polymerase (Genscript). DNA fragments resolved with electrophoresis of 1.2% Agarose gel purified using the Gel Extraction Kit (Qiagen ...
-
bioRxiv - Genomics 2023Quote: The ACE2 coding sequence was synthesized by PCR amplification from the pUC57-ACE2 plasmid (GenScript). We included a NheI restriction site at the 5’ terminus and a PmeI restriction site at the 3’ terminus ...
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Microbiology 2022Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Cancer Biology 2022Quote: Human RET-GFP and RET712-1114-GFP were cloned by PCR using a cDNA clone (GenScript Biotech; NM_020975.6) as template ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting PCR products were analysed by agarose gel electrophoresis and confirmed by Sanger sequencing (GenScript, Nanjing, China). The genome editing plasmids were cured following the method we previously developed (Zheng et al ...
-
bioRxiv - Immunology 2024Quote: ... the commercialized ELISA kit (Genscript, Cat#L00871) was used ...
-
bioRxiv - Microbiology 2020Quote: ... hnRNPUL1 (NM_007040) and PEG10 (NM_015068.3) were PCR amplified from ORF clones (hnRNPL, GenScript #OHu14072; hnRNPUL1, Origene #RC200576; PEG10, GenScript #OHu101111) and the products were cloned into the mammalian expression plasmid pCAGGS ...
-
bioRxiv - Microbiology 2022Quote: All constructs were PCR amplified from a codon optimized gene block encoding the coding sequence of human DYRK1A (GenScript) using Q5 High-Fidelity DNA Polymerase with GC enhancer buffer (New England Biolabs) ...
-
bioRxiv - Bioengineering 2022Quote: ... by means of overhang PCR and was cloned via traditional restriction/ligation into a pET28a(+) plasmid (ordered from GenScript) coding for the C-terminal flexible linker and small BiT (SB ...
-
bioRxiv - Biochemistry 2022Quote: The C-terminally His-tagged construct encoding human UGGT1 residues 43-1551 was PCR-amplified from the commercially sourced vector UGGT1-pUC57 (GenScript) with primers ...
-
bioRxiv - Systems Biology 2022Quote: ... The following primers were used for the RT-qPCR reaction (designed with the Real-time PCR (TaqMan) Primer and Probes Design Tool from GenScript).
-
bioRxiv - Molecular Biology 2020Quote: ... A version of the LdNT3 stem-loop was synthesized with flanking BstXI and PCR primer binding sites (Genscript, Piscataway, NJ) and inserted into the BstXI sites of the modified pRP vector.
-
Activation of endoplasmic reticulum stress via clustering of the inner nuclear membrane protein SUN2bioRxiv - Cell Biology 2022Quote: ... and SUN2-N-2 (AA 1-226) fragments by PCR from pcDNA3.1+/C-(K)DY-SUN2 vector (OHu01874,GenScript # NM_001199579.1) and subsequent cloning into MP029-CRY2-mCherry lentiviral vector using the NheI/XbaI restriction sites ...
-
Activation of endoplasmic reticulum stress via clustering of the inner nuclear membrane protein SUN2bioRxiv - Cell Biology 2022Quote: ... The construct consisting of nucleoplasmic and transmembrane domains of SUN2 and the luminal domain of SUN1 was created by amplifying SUN1 C-terminal fragment (AA 245-511) by PCR from pcDNA3.1+/C-(K)DY-SUN1 vector (OHu26731,GenScript # NM_001130965.3) using 5’-CTGTTCTAGAATGTTGGCTGGCCGTGG-3’forward and 5’-CTGTCTCGAGGCCCTGACTTGCACGTCCA-3’ reverse primers and subsequent cloning into MP029-CRY2-mCherry-SUN2-N-2 vector using the XbaI/XhoI restriction sites ...