Labshake search
Citations for GenScript :
51 - 100 of 200 citations for Hexadecanoic acid 3 trimethylsilyl oxy methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... All utrophin 3’UTR reporter constructs were generated by GenScript Biotech (Leiden ...
-
bioRxiv - Molecular Biology 2023Quote: The published DARPin TM-3 sequence22 was synthesized by GenScript and cloned into a pST50 expression vector27 with N-terminal 6x His tag using Gibson assembly ...
-
bioRxiv - Neuroscience 2024Quote: ... Urocortin 3 (Ucn3; GenScript USA, Piscataway, NJ: 60pmol/0.4μl/side) was dissolved in DMSO (10% v/v final concentration ...
-
bioRxiv - Immunology 2020Quote: ... The S1-N-terminal domain (S1-NTD, amino acids 16-318) was custom synthesized by GenScript. Each protein was expressed with an N-terminal His6-Tag to facilitate purification ...
-
bioRxiv - Immunology 2021Quote: ... A peptide representing the mouse ANGPTL4 amino acids 29-53 (29QPEPPRFASWDEMNLLAHGLLQLGH53) was also synthesized by Genscript) with the same C-terminal-GGGC modification ...
-
bioRxiv - Bioengineering 2024Quote: The sEVs were modified with a 29-amino-acid peptide (YTIWMPENPRPGTPCDIFTNSRGKRASNG; GenScript USA, Inc., NJ, USA), derived from RVG using the previous method.71 DOPE-PEG3400-NHS (dioleoylphosphatidylethanolamine poly (ethylene glycol)3400 N-hydroxysuccinimide ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... 3 gRNAs were designed around the SNPs and synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...
-
bioRxiv - Microbiology 2024Quote: ... The 2-mer and 3-mer oligos were ordered from GenScript USA ...
-
bioRxiv - Bioengineering 2020Quote: ... in the presence of varying amounts of argininylglycylaspartic acid (RGD, CGRGDS, 2.0 mM, Genscript, George Town, KY), heparin-binding peptide (HBP ...
-
bioRxiv - Biochemistry 2022Quote: ... A peptide corresponding to the human CRX homeodomain (amino acids 39 to 98) was synthesized by Genscript.
-
bioRxiv - Cell Biology 2024Quote: A E.coli codon optimized DNA fragment corresponding to amino acids 32-442 of RON11 was synthesized (Genscript) and cloned into pMAL vector (NEB ...
-
bioRxiv - Immunology 2022Quote: RBD-CompA gene based on previously described amino acid sequence [24] was synthesized and cloned by Genscript in the pcDNA3.4+ vector.
-
bioRxiv - Biophysics 2023Quote: ... Some single amino acid mutants were generated by site-directed mutagenesis and others were purchased synthesized (GenScript).
-
bioRxiv - Plant Biology 2024Quote: A plasmid encoding CAMTA2-NT (amino acids 1-364) driven by the SP6 promoter was synthesized (GenScript) and 4μg of plasmid expressed in the TnT Wheat Germ Extract Kit (Thermo ...
-
bioRxiv - Molecular Biology 2022Quote: ... pGEX4T-1-SUMO1-3 was designed by AJG and made by GenScript by cloning SUMO1-3 cDNA into BamHI and EcoR1 restriction sites ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then transfected with 3 μg of CXCR3A plasmids (GenScript, OHU18425C) or CXCR3B expression construct (GenScript ...
-
bioRxiv - Immunology 2022Quote: ... A total of 500,000 splenocytes were restimulated ex vivo with the full-length SARS-CoV-2 B.1.1.529 S 15-mer (overlapping by 11 amino acids) peptide pool (GenScript) in plates pre-coated with anti-IFN-γ or anti-IL-4 antibodies ...
-
bioRxiv - Biophysics 2022Quote: ... A 23 amino acid synthetic peptide corresponding to the X-31 FP domain56 was custom synthesized by GenScript, NJ labelled with tetra-methyl rhodamine (Sequence ...
-
bioRxiv - Immunology 2021Quote: 15-mer peptides that are overlapping by 10 amino acids (AA) spanning the entire SARS-CoV-2 Spike protein (GISAID EPI_ISL_410713) were synthesized (Genscript) and pooled into 7 pools of approximately 40 peptides in each pool (Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: Fluorescein isothiocyanate (FITC) labeled peptides corresponding to the carboxyl-terminal 10 amino acids of Yhl045w (FITC-RKRVLGVAYL, Genscript) and Idp3 (FITC-YEDKKGMCKL ...
-
bioRxiv - Genetics 2022Quote: The designed 3 pegRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: The 50-residue synthetic peptide used in Figure 3 was synthesized by GenScript USA Inc ...
-
bioRxiv - Genetics 2024Quote: ... 3’ sequence: GTT TTA GAG CTA GAA ATA GCA AGT TAA AAT) (Genscript), amplified with outside primers corresponding to the 5’ constant sequence and the reverse complement of the 3’ constant sequence in 17 cycles using Phusion Polymerase (New England Biolabs) ...
-
bioRxiv - Cell Biology 2021Quote: The following peptides corresponding to the Sst2 amino acid sequence surround Serine 539 were synthesized by Genscript (Piscataway NJ), the phospho-Sst2 S539 peptide LHPHSPLSEC ...
-
bioRxiv - Biochemistry 2020Quote: SARS-CoV-2 nsp12 gene (amino acid 4393-5324 Uniprot: P0DTD1) was synthesized de novo by GenScript (Nanjing, China) and constructed onto pET22b vector between NdeI and XhoI sites ...
-
bioRxiv - Biophysics 2020Quote: ... or a SARS-CoV (amino acid residues 1 to 1193) (GenBank: AAS00003.1) were synthesized using -optimized codons for Cricetulus griseus (CHO Cell) by GenScript. The cDNAs were subcloned into pTRIMER expression vector (GenHunter ...
-
bioRxiv - Immunology 2020Quote: ... protein (amino acid residues 1 to 1211) (GenBank: MN908947.3) was gene-synthesized using Cricetulus griseus (Chinese hamster)-preferred codons by GenScript. The cDNA was subcloned into pTRIMER expression vector (GenHunter Corporation ...
-
bioRxiv - Immunology 2022Quote: ... Samples were stimulated using pooled Spike peptides of SARS-CoV-2 (Final concentration:1μg/mL, 15-mer peptide with 11 amino acids covering the spike region, Genscript) and cultured at 37°C with 5% CO2 for 20 h ...
-
bioRxiv - Cell Biology 2024Quote: FITC-labeled aminocaproic acid-disulfide-cyclized ACRGDGWCG peptide (FITC-cyclic-ACRGDGWCG) and FITC-labeled aminocaproic acid-GRGDLGRLKK peptide (FITC-proTGFβ3 peptide) were synthesized by GenScript. Preliminary experiments (Supplementary Fig ...
-
bioRxiv - Biophysics 2023Quote: ... fused to enhanced yellow fluorescent protein by an 18 amino acid flexible linker (EFC-SRRYRGPGIHRSPTA) was synthesized and cloned into the pcDNA3.1(+) expression vector by GenScript. The Tau4RD*LM-YFP sequence was then subcloned into the pIRESpuro3 vector (Takara ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The sialic acid synthase protein (NCBI accession # XP_021429200) was commercially produced using the insect expression vector pFastBac1 (GenScript U488UFB180).
-
bioRxiv - Molecular Biology 2023Quote: ... Afp18N20EtA (Afp18N20EtA: MPYSSASKAKATHSKATARD, glutamic acids to alanines) were synthesized and subcloned into pET11a_afp18NT20-casΦ-2 (replacing afp18NT20) by Genscript.
-
bioRxiv - Neuroscience 2024Quote: ... human α-synuclein cDNA sequences fused to enhanced yellow fluorescent protein by an 18 amino acid flexible linker (EFCSRRYRGPGIHRSPTA) were synthesized and cloned into the pcDNA3.1(+) expression vector by GenScript. The α-syn140-YFP sequences were then subcloned into the pIRESpuro3 vector (Takara ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-GCGUCGCAGGCCUUUUUAUU-3’; 0.39 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2022Quote: The previously designed 3 gRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... VHL 3KR-14-3-3ζ (1-230) 19KR K49E mutation were synthesized by GenScript Biotech ...
-
bioRxiv - Neuroscience 2024Quote: ... a single dose (3 nmol/g) of peptides TMyc or TT1Ct (> 95% purity; GenScript), solubilized as 2.5 mM solutions in 0.9% NaCl ...
-
bioRxiv - Immunology 2021Quote: ... Peptide pools consisted of 15-mer peptides overlapping by 11 amino acids and spanned the entire S and N proteins of SARS-CoV-2 (GenScript). After stimulation ...
-
bioRxiv - Immunology 2021Quote: ... The splenocytes were stimulated for 20 hours at 37°C with RBD peptides (15-mer peptides overlapping by 9 amino acid spanning the RBD of SARS-CoV-2 spike protein, GenScript), at 5μg/mL of each peptide in RPMI + 10% FBS (R10) ...
-
bioRxiv - Bioengineering 2020Quote: Codon-optimized forms of human ACE2 binding region (amino-acids 19-615) and modified ACE2 genes were chemically synthesized (Genscript), and were subcloned upstream of a human Fc region (derived from IgG1 ...
-
bioRxiv - Biophysics 2021Quote: A plasmid expressing mature OmpA without the 22 amino acid signal sequence in the pET303 vector was purchased from Genscript for cloning of the modified loop constructs ...
-
bioRxiv - Cell Biology 2022Quote: ... (amino acids 571-1255) was synthesized and cloned into modified pET23b vector at the AgeI and NotI restriction sites (Genscript). Purification of 6×His-mDia1(FH1-C ...
-
bioRxiv - Immunology 2022Quote: ... Peptide pools consisted of 15-mer peptides overlapped by 11 amino acids and spanning the entire S and N proteins of SARS-CoV-2 (GenScript). After stimulation ...
-
Sterilizing immunity against SARS-CoV-2 in hamsters conferred by a novel recombinant subunit vaccinebioRxiv - Microbiology 2020Quote: ... cells were incubated with pooled peptides of SARS-CoV-2 spike (15-mer peptides with 11 amino acids overlap, cover the entire spike protein, Genscript) and cultured for 20 hours ...
-
bioRxiv - Pathology 2021Quote: ... lung or PBMCs immunized with 1×106 PFU of vaccine were plated into each well and stimulated for 20 h with pooled peptides of RBD of wild type SARS-CoV-2 or variants (15-mer peptide with 11 amino acids overlap, cover the spike, Genscript). The spots were developed based on the manufacturer’s instructions ...