Labshake search
Citations for GenScript :
51 - 100 of 501 citations for Glutathione Fluorescent 384 Well Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Cells were plated in a 6 well plate and co-transfected with 1 μg of pUC57-NASP-FKBP12F36V (by Genscript) and 2 μg of pSpCas9(BB)-2A-Puro-NASP-sgRNA_V2.0 (#62988 ...
-
bioRxiv - Microbiology 2023Quote: ... The soluble protein fraction of cells expressing GST-tagged proteins was incubated with glutathione resin (GenScript; L00206) at 4°C for 1 h with constant rotation (10 rpm) ...
-
bioRxiv - Immunology 2021Quote: ... biotinylated detection antibody (GenScript, Cat# 5E10G8-Biotin) was added at 1 µg/mL final concentration in blocking buffer and plate was incubated at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: Fluorescent-tagged phage proteins were synthesized into pDSW206 by Genscript and delivered as lyophilized plasmid ...
-
bioRxiv - Biochemistry 2023Quote: ... The resulting lysate was centrifuged at 12,000 x g to separate the soluble protein fraction and incubated with glutathione resin (GenScript) for 30 minutes while shaking at room temperature (RT) ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit (GenScript, L00847-A) was used according to the manufacturer’s instructions as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... In white clear bottom 96-well plates 10 μL IL-34 antibody (mouse monoclonal IgG2A (v1.1 manufactured by Genscript, Ma et al., 2012), rat monoclonal IgG2A (MAB5195 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified FLAG-tagged proteins were cleaved from MBP or Glutathione S-transferase (GST) using 3C protease (Genscript #Z03092-100) and their purity was analyzed by SDS-PAGE.
-
bioRxiv - Cell Biology 2024Quote: ... and eluted from the column by incubation with either reduced glutathione (to retain the GST tag) or with 10 units Prescission Protease (Genscript) to obtain protein without a tag ...
-
bioRxiv - Synthetic Biology 2023Quote: The expression levels of his-tagged nanobodies resulting from microfermentations were quantified using the His tag ELISA detection kit (GenScript, Cat# L00436) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: Binding of the fluorescent transport substrate peptide RRY(CFluorescein)KSTEL (Genscript) to WT and mutant TmrAB was determined as a function of the change in fluorescence polarization as described in [10] ...
-
bioRxiv - Bioengineering 2019Quote: ... OmpT fluorescent peptide substrate was custom ordered from Genscript (Piscataway, NJ).
-
bioRxiv - Neuroscience 2024Quote: ... An additional plasmid encoding green fluorescent protein (GFP; pCAG-GFP; GenScript), was used to label successfully transfected cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Neutralizing antibodies against the SARS-CoV-2 in hamster blood plasma were determined using the “SARS-CoV-2 Surrogate Virus Neutralization test kit” (GenScript, USA).
-
bioRxiv - Immunology 2022Quote: ... were coated overnight with 250 ng/well of purified recombinant Coronavirus proteins and 500 ng/well of a SARS-CoV-2 fusion sequence-containing peptide (KRSFIEDLLFNKVTLADAGFIK, GenScript Biotech). After washings with 0.05% Tween 20-PBS (washing buffer) ...
-
bioRxiv - Microbiology 2021Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit from GenScript (REF: L00847) was used according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 100 μL of cell lysate was saved as an input control and the remaining cell lysate was incubated with Glutathione MagBeads (GenScript, L00327) overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of pseudovirus infection of cells containing SARS-CoV-2 receptors was performed on serum specimens using two commercially available SARS-CoV-2 LVV-PsN Kit (SC2087A; SC2087L; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of ACE2 binding to SARS-CoV-2-RBD was performed on serum specimens using a commercially available SARS-CoV-2 sVNT Kit (L00847; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The fluorescent NOXA and BID peptides (95+% purity) were synthesized by GenScript and were N-terminally labeled with 5-FAM-Ahx and C-terminally modified by amidation ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Molecular Biology 2021Quote: The SARS-CoV-2 surrogate virus neutralization test (sVNT) kit was obtained from GenScript Inc ...
-
bioRxiv - Immunology 2021Quote: RBD and NP end-point titers were determined using standard ELISA and plates coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) or 1ug/mL SARS-CoV-2 nucleocapsid protein (NP) ...
-
bioRxiv - Immunology 2021Quote: RBD end-point titers were determined using standard ELISA and plates were coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) Heat inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Immunology 2021Quote: Neutralizing antibodies were measured using a SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript). Hamster sera was diluted from 1:20 to 1:500 incubated at a 1:1 ratio with HRP conjugated SARS-CoV-2 RBD protein for 30 min at 37°C ...
-
bioRxiv - Zoology 2020Quote: ... 10 wells (Genscript, Nanjing, China). Gels were stained with Coomassie brilliant blue using eStainTM L1 (Genscript).
-
bioRxiv - Microbiology 2022Quote: ... fumigatus-optimized fluorescent protein mNeonGreen by using vector pSR25 (synthesized by GenScript, Piscataway, NJ). Primer pairs AtrR-CoNG MH F (CCCGGTCTTCGACACCA ATGGTCCACCCCACGGTGGATTGGCTGGTGCCGGTGCTGGT ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA (4) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... with an Applied Bio-Rad CFX96 Sequence Detection system (Genscript, NanJing, China) was used in the real-time PCR procedure ...
-
bioRxiv - Plant Biology 2023Quote: ... SCOOP10 and SCOOP12 peptides were labeled with fluorescent 5-FAM at the N-termini (GenScript, China) and the final working concentration of labelled peptides was adjusted to 0.05 μM with ddH2O ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The RBD-ACE2 assay was performed using SARS-CoV-2 sVNT ready to use kit sold by Genscript Inc ...
-
bioRxiv - Immunology 2020Quote: Neutralizing antibodies were routinely detected based on the SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) kit (GenScript). This ELISA-based kit detects antibodies that hinder the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Immunology 2022Quote: ... 0.1×106 mouse splenocytes were plated into each well and stimulated overnight with 0.2 µg per peptide per well of RBD-derived overlapping peptides (GenScript).
-
bioRxiv - Biochemistry 2021Quote: RBD-ACE2 binding competition assay was developed using the SARS-CoV-2 surrogate virus neutralization test kit (Genscript, NJ). First a 5-fold dilution series of RBD variant starting at 10 μM was prepared in sample dilution buffer in duplicate ...
-
bioRxiv - Immunology 2022Quote: The neutralizing activity of mouse serum samples was detected by SARS-CoV-2 Surrogate Virus Neutralization Test Kit (L00847A, GenScript). Detections were performed according to manufacturer’s instruction ...
-
bioRxiv - Immunology 2021Quote: Blocking of the RBD-ACE2 interaction by the mouse sera was assessed using a SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript) (Tan et al ...
-
bioRxiv - Biochemistry 2023Quote: Remaining samples of sera from corresponding administration routes along with prebleed samples were pooled and passed through a protein A column and the recovered IgGs used in SARS-CoV-2 surrogate virus neutralisation assays (sVNT) 38 using a commercial kit (GenScript).
-
bioRxiv - Microbiology 2020Quote: ... Target proteins were obtained with purity >85% and endotoxin level <2 EU/mg (LAL Endotoxin Assay Kit, GenScript, Cat. No. L00350). In addition ...
-
bioRxiv - Neuroscience 2024Quote: ... and FAT-2 (Genscript) cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215 ...
-
bioRxiv - Immunology 2021Quote: ... as well as anti- GAPDH– HRP conjugate (A00192; GenScript), incubations were carried out for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... DOPE-MPB lipids were then reacted with the terminal cysteine residue of a fluorescent CtermCldn4 peptide (300 nM, 5-FAM-Ahx-CPPRTDKPYSAKYSAARSAAASNYV, GenScript) for 1 hr at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... a library of potential substrates flanked by 5FAM fluorescent dye and DABCYL quencher (5FAM-substrate-Lys{DABCYL}-Amide) was synthesized by Genscript or manufactured in-house using Liberty Blue peptide synthesizer (CEM) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Mpro inhibition assay was performed using the FRET-based fluorescent peptide substrate DABCYL-KTSAVLQ↓SGFRKM-E(EDANS)-NH2 (purchased from Genscript). The assay was standardized with enzyme concentration of 140 nM and 30 µM of fluorescent substrate in Mpro assay buffer containing (20 mM Tris pH 7.3 ...
-
bioRxiv - Neuroscience 2023Quote: ... SnifferOT cells were transiently transfected to express the red fluorescent genetically encoded calcium indicator R-GECO (GenScript, Piscataway, NJ, USA) with Fugene HD reagent (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: The surrogate virus neutralization test (sVNT) assay was performed using the SARS-CoV-2 surrogate virus neutralization test kit (GenScript, NJ, USA). Briefly ...
-
bioRxiv - Biochemistry 2020Quote: ... as well as phosphorylated serine modifications were synthesized by GenScript and purified by HPLC to 98% purity ...
-
bioRxiv - Cancer Biology 2023Quote: ... as well as human EGFR (GenScript, Piscataway, NJ; Cat# Z03194) as a control surface ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... SARS-CoV-2 pseudovirus (Genscript) was diluted in DMEM complete media to an IFU of 3.2e7/mL ...