Labshake search
Citations for GenScript :
51 - 100 of 179 citations for Cow Serine protease HTRA2 mitochondrial HTRA2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Western blotting procedures to determine the proteolytic cleavage of the HA were carried out as previously described.24,33 HEK293T cells were co-transfected with pCAGGS expression plasmids encoding for the corresponding HA and pcDNA3.1 plasmids encoding human airway proteases (Genscript). The Western blotting procedure was carried out with cell lysates ...
-
bioRxiv - Bioengineering 2023Quote: ... % Me-HA conjugated with 0.5 mM integrin binding peptide (RGD) was crosslinked with a protease-cleavable peptide (KKCG-GPQGIWGQ-GCKK, Genscript) in phenol red-free serum-free Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified FLAG-tagged proteins were cleaved from MBP or Glutathione S-transferase (GST) using 3C protease (Genscript #Z03092-100) and their purity was analyzed by SDS-PAGE.
-
bioRxiv - Biochemistry 2020Quote: The full-length human NatD gene was amplified and cloned into a modified pET-21a(+) vector containing an 8x-His-tag and SUMO protease cleavage site at the N-terminus (Genscript). This pET-21a(+)-hNatD construct was transformed into Escherichia coli BL21 (DE3 ...
-
bioRxiv - Cell Biology 2020Quote: ... S100 supernatant was added directly to 600 μL of basic lysis buffer with protease inhibitors and NEM containing 30 μL 1:1 anti FLAG Affinity Gel (Genscript). All samples were incubated overnight at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: ... a linker region (DYDIPTT) and a Tobacco Etch Virus (TEV) protease site (ENLYFQG) in a pET-22b vector were purchased from Genscript. Site-directed mutagenesis was performed using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2021Quote: ... The codon-optimized gene encoding for these residues plus an engineered DNA sequence encoding for a C-terminal tobacco etch virus (TEV)-protease cleavage site (ENLYFQS) was synthesized by GenScript. This gene was then subcloned into the ampicillin-resistant ...
-
bioRxiv - Biochemistry 2021Quote: ... was cloned into the pGEX-6P-1 plasmid with an N-terminal GST tag and precision protease cleavage site after codon optimization by DAPCEL and synthesis by GenScript. The plasmid was then transformed into E ...
-
bioRxiv - Biophysics 2022Quote: ... coli optimized codons for the C0-C2 portion of human cMyBP-C with N-terminal 6x His tag and TEV protease cleavage site were obtained from GenScript. C0-C2 mutants were engineered using a Q5 Site-Directed Mutagenesis Kit (New England Bio Labs) ...
-
bioRxiv - Biophysics 2022Quote: ... construct cloned in a pGEX-6P-1 vector with an N terminal GST-tag followed by a precision protease site was obtained from GenScript.
-
bioRxiv - Microbiology 2023Quote: ... The plasmid encoding Wag31 with an N-terminal 6xHis tag followed by a TEV protease cleavage site (pET-His-TEV-Wag31) was synthesized by Genscript. The Wag31 N-terminal DivIVA domain (Wag311-61 ...
-
bioRxiv - Biochemistry 2023Quote: ... vector encoding WT DosS CA (amino acids 454 – 578 of full-length DosS) sequence with an N-terminal 6xHis tag and a TEV protease site was purchased from GenScript. DosS CA mutants were prepared from the WT plasmid via site-directed mutagenesis with end-to-end primers similar to methods described in previous papers.22 The forward and reverse primers (5’ to 3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... the gene was inserted between the BamHI and EcoRIsites of the vector pGEX-4T-1 with an N-terminal GST tag followed by an HRV 3C protease cleavage site. The DNA sequence encoding yeast (S. cerevisiae) Ubc4 was synthesized by GenScript and its codon was optimized for E ...
-
bioRxiv - Cell Biology 2024Quote: ... and eluted from the column by incubation with either reduced glutathione (to retain the GST tag) or with 10 units Prescission Protease (Genscript) to obtain protein without a tag ...
-
bioRxiv - Biochemistry 2024Quote: ... and synthesized and cloned into the pET-DUET-1 vector with a C-terminal Tobacco Etch Virus (TEV) protease cleavage site (ENLYFQG) and hexahistidine tag (His6) (GenScript). The expression construct was transfected into E ...
-
bioRxiv - Biophysics 2024Quote: ... or C154Y mutants optimized for expression in yeast were cloned in a pPIC9K vector upstream of a sequence coding for a PreScission protease cleavage site (LEVLFQGP) followed by a linker of 11 amino acids and a 10His tag (GenScript). The plasmids were introduced in Pichia pastoris strain SMD1163 (his4 ...
-
bioRxiv - Biophysics 2020Quote: SARS CoV-2 main protease (Mpro or 3CL) gene from strain BetaCoV/Wuhan/WIV04/2019 was ordered from GenScript (Piscataway, NJ) in the pET29a(+ ...
-
bioRxiv - Microbiology 2022Quote: ... the chromatography column was resuspended with 1 ml TCB as well as 20 μl (200 U) of TE protease enzyme (Genscript, Inc) on a rotator and the columns incubated at 4°C for 16 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... for non-degradable gels) or mixtures of PEGSH and protease-degradable peptide (VPM peptide, GCRDVPMSMRGGDRCG, purity 96.9%, Mw 1696.96 Da, GenScript; for degradable gels). SFs were mixed with the protein and PEGMAL before addition of the crosslinker ...
-
bioRxiv - Biochemistry 2020Quote: ... expression vector with an N-terminal His6-tag and a TEV protease recognition site for removal of the tag (GenScript; Piscataway, NJ). In addition ...
-
bioRxiv - Biochemistry 2021Quote: ... were each synthesised with a N-terminal honeybee melittin signal peptide and a C-terminal TEV protease cleavage site and His6-tag by GenScript (Hong Kong) and subcloned into the pFastBac1 vector.
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids for codon-optimized pET-28a- His6-nsp7-8 and pET-28a-His6-nsp7-11 (with an HRV 3C protease cleavage site between the 6x- His tag and the coding sequence) were obtained from GenScript (Piscataway, NJ). Primers used for cloning and mutagenesis ...
-
bioRxiv - Biophysics 2020Quote: ... SARS CoV-2 papain-like protease (PLpro) gene (ORF 1ab 1564 to 1876) from strain BetaCoV/Wuhan/WIV04/2019 was ordered from GenScript (Piscataway, NJ) in the pET28b(+ ...
-
bioRxiv - Biophysics 2021Quote: ... coli optimized codons for the C0-C2 portion of human cMyBP-C with N-terminal 6x His tag and TEV protease cleavage site were obtained from GenScript (Piscataway, NJ). For TR-FRET binding assays ...
-
bioRxiv - Biochemistry 2023Quote: ... Equilibrated Ni-NTA resin was added to the products to bind the MBP-His tag and the His-tagged TEV protease (Genscript, Cat. # Z03030) while allowing the purified FAM210A-dMTS cleaved product to be collected in the flowthrough ...
-
bioRxiv - Immunology 2024Quote: ... the Thosea assigna virus (TAV) 2A protease and the mature IGIP was generated with a cloning spacer downstream and acquired from Genscript (Piscataway, NJ). The fragment was digested with AarI (Thermo Scientific ...
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Genomics 2023Quote: ... with CloneEZ PCR Cloning Kit (GenScript #L00339). The pLenti-GIII-EF1α-CBX3-Flag-HA ...
-
bioRxiv - Microbiology 2022Quote: The ToxinSensor Chromogenic LAL Endotoxin Assay kit (GenScript) was used to determine endotoxin units/mL of culture ...
-
bioRxiv - Neuroscience 2024Quote: ... a toxin Eraser endotoxin removal kit (#L00338, Genscript) with a high efficiency endotoxin removal resin was employed ...
-
bioRxiv - Neuroscience 2023Quote: ... using the High-Affinity Antibody Purification Kit (L00404, GenScript) following the manufacturer’s protocol.
-
bioRxiv - Bioengineering 2020Quote: ... and measured by ToxinSensor Chromogenic LAL Endotoxin Assay Kit (Genscript). The purified Nbs were further sterilized by passing a 0.2 μm filter (Millex ...
-
bioRxiv - Immunology 2020Quote: For the surrogate neutralization assay the cPass kit from GenScript was used (Cat ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... ToxinSensor Gel Clot Endotoxin Assay Kits were purchased from GenScript. VacciGrade LPS was purchased from InvivoGen.
-
bioRxiv - Microbiology 2021Quote: ... endotoxin was removed with the ToxinEraser™ Endotoxin Removal Kit (Genscript), and the endotoxin level was measured using the ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (Genscript ...
-
bioRxiv - Microbiology 2020Quote: ... or with the ONE-HOUR Western™ Standard Kit (Genscript, China).
-
bioRxiv - Immunology 2020Quote: ... were depleted of endotoxin with the ToxinEraser Endotoxin Removal kit (GenScript) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... generated using the GenCrispr sgRNA Screening Kit (L00689; Genscript Biotech Corp.), and diluted to a concentration of 4 uM ...
-
bioRxiv - Microbiology 2022Quote: ... Endotoxin levels were quantified using ToxinSensor™ Chromogenic LAL Endotoxin kit (GenScript) to ensure toxin purity.
-
bioRxiv - Neuroscience 2020Quote: ... with endotoxin levels determined using a LAL chromogenic endotoxin quantification kit (GenScript). Mouse or human α-synuclein fibrils were prepared by incubation of 7 mg ml -1 α-synuclein monomer of the same origin in phosphate-buffer saline for seven days at 37°C with constant agitation ...
-
bioRxiv - Microbiology 2021Quote: ... the cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (Genscript, L00847), was used as directed to detect antibodies that bind competitively to the receptor binding domain (RBD ...
-
bioRxiv - Biochemistry 2022Quote: The commercially available SARS-CoV-2 Neutralization Antibody Detection Kit (cPass, GenScript) was used to identify the presence of RBD neutralizing antibodies in the serum samples from mice immunized with r3CL-pro ...
-
bioRxiv - Developmental Biology 2022Quote: ... Inserts were ligated using GenBuilder™ Cloning Kit (Genscript, Piscataway NJ, USA) into pGL3-Basic (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... Endotoxin levels were determined using a LAL chromogenic endotoxin quantification kit (GenScript).
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit (GenScript, L00847-A) was used according to the manufacturer’s instructions as follows ...
-
bioRxiv - Microbiology 2020Quote: ... The remnant endotoxin was identified with ToxinSensorTM Chromogenic LAL Endotoxin Assay Kit (Genscript) and no more than 0.1 EU/mL of endotoxin was detected.