Labshake search
Citations for GenScript :
51 - 100 of 221 citations for 7 Amino 1H benzimidazole 5 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... OLP peptide pools of 15mers with 11 amino acid overlap were generated spanning the SARS-CoV-2 Spike RBD (R319-S591, GenScript). Sequences that contained VOC mutations were exchangeable with the corresponding mutated peptides due to a modular OLP pool design.
-
bioRxiv - Molecular Biology 2020Quote: The EPYC1 full-length gene (encoding amino acids 1-317) and corresponding R/K mutant (EPYC1R64A/K127A/K187A/K248A/R314A) were synthesized by GenScript and cloned between the SacII and HindIII site of the pHue vector48 ...
-
bioRxiv - Immunology 2021Quote: ... 15-mer peptides with 11 amino acids overlap that cover the full length of S protein of SARS-CoV-2 were individually synthesized (GenScript). Peptides were dissolved in DMSO at 12 mg each peptide/ml and 8-12 peptides were mixed to create 75 different semi-pools so that the responsible epitopes can be determined from the reactivities of horizontal and vertical pools ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse Tmod3 amino acid sequence with locations of peptides (red – Nterm, blue - Cterm) used to custom prepare chicken anti-Tmod3 antibodies (Genscript). A commercial rabbit anti-Tmod3 antibody (Aviva ...
-
bioRxiv - Immunology 2020Quote: ... Peptide pools consisted of 15-mer peptides overlapping by 11 amino acids and spanned the entire SARS-CoV-2 S protein (GenScript). After stimulation ...
-
bioRxiv - Biochemistry 2022Quote: ... a plasmid containing 400 bp upstream of the VPH1 open reading frame followed by the SPVD chimera and 400 bp corresponding to Vph1CT amino acids 406-539 cloned into pBluescript II KS(-) vector using BamHI and XhoI was purchased from Genscript. After restriction digestion with BamH1 and Xho1 ...
-
bioRxiv - Biochemistry 2023Quote: Full-length human BAP1 and the deubiquitinase adaptor domain (DEUBAD) of ASXL1 (amino acids 237-390) were cloned into a pFastBac Dual vector by GenScript. ASXL1 was subcloned into pET24a vector for E ...
-
bioRxiv - Immunology 2023Quote: 15-mer peptides with 11 amino acids overlap that cover the full length of S protein of SARS-CoV-2 were synthesized (GenScript). Peptides were dissolved in DMSO at 12 mg/ml and 12-15 peptides were mixed to create 26 different semi-pools ...
-
bioRxiv - Immunology 2023Quote: Full length Erdr1 (Erdr1-177) and Erdr1 deficiency C-terminal 32 amino acid (Erdr1-145) with C-terminal HA tags was synthesized (GenScript) and cloned into pcDNA3.1 plasmid using In-Fusion cloning (Clontech) ...
-
bioRxiv - Cell Biology 2023Quote: The antibody against B55α was generated by immunizing rabbits with a synthetic peptide corresponding to the first 15 amino acids of the N-terminal region of B55α (MAGAGGGNDIQWCFS) conjugated to keyhole limpet hemocyanin (Genscript). The resulting sera were purified with CNBr-activated sepharose 4 Fast Flow (GE Healthcare ...
-
bioRxiv - Genetics 2023Quote: An antibody against CENP-C made in guinea pig was made by generating a clone expressing amino acids 502-939 (Genscript). This guinea pig anti-CENP-C was used at 1:1000 ...
-
bioRxiv - Cell Biology 2024Quote: ... (Biotin-GRMTNGAMNVEIGNPTYKMYEGGEPDDG) and LRP1 (NPXA) (Biotin-GRMTNGAMNVEIGNPTAKMYEGGEPDDG) peptides corresponding to human LRP1 amino acid residues 4458-4483 were purchased from GenScript and ...
-
bioRxiv - Biophysics 2024Quote: ... or C154Y mutants optimized for expression in yeast were cloned in a pPIC9K vector upstream of a sequence coding for a PreScission protease cleavage site (LEVLFQGP) followed by a linker of 11 amino acids and a 10His tag (GenScript). The plasmids were introduced in Pichia pastoris strain SMD1163 (his4 ...
-
bioRxiv - Cell Biology 2019Quote: ... The polyclonal antibody used to purify γ-TuRC from Xenopus egg extract was generated against a purified γ-tubulin peptide (amino acids 412-451) through a commercial vendor (Genscript). The presence of γ-TuRC during its purification was tracked via Western blotting using the GTU88 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lamin-C was overproduced and purified from codon-optimized Lamin-C (amino acid residues 1-152) engineered into pRSF-Duet plasmid (Genscript Inc.). The construct carries a tandem N-terminal Strep-tag ...
-
bioRxiv - Cell Biology 2020Quote: ... Trp68 rabbit polyclonal antibodies were custom generated and affinity purified against the TDP-43 amino acid sequence 65DAGWGNL71 by GenScript (Piscataway, NJ).
-
bioRxiv - Molecular Biology 2021Quote: ... elephas VTG amino acid sequence deduced in silico (Fig. 1A) was used to create two synthetic peptides (Fig 1B) (Genscript USA Inc.) to be employed for the production of specific anti-VTG antibodies (Twin Helix ...
-
bioRxiv - Microbiology 2021Quote: ... and JPS-G3 VHHs [20] separated by 15-amino acid flexible glycine-serine linkers ((GGGGS)3) was synthesized (GenScript Biotech, Piscataway, NJ) and ligated into pET32b(+ ...
-
bioRxiv - Bioengineering 2019Quote: ... transferred onto PVDF membranes and probed with primary antibodies raised in rabbit against a synthetic PmHAS peptide (NDNDLKSMNVKGAS, amino acids 860 to 874, prepared by GenScript, Hong Kong) and/or a monoclonal mouse anti-FLAG M2 antibody (F3165 ...
-
bioRxiv - Immunology 2021Quote: ... resuspended at a density of 15 million/mL in complete RPMI and 100 μL of cell suspension containing 1.5 million cells was added to each well of a 96-well round-bottomed tissue culture plate and stimulated ex vivo with a peptide pool consisting of 15mer peptides overlapping by 11 amino acids spanning the S protein (GenScript, Piscataway, NJ), at a concentration of 1.2 μg/mL of each peptide in the presence of 1 μg/mL anti-CD28 ...
-
bioRxiv - Immunology 2022Quote: ... and 1-3 x 105 cells were stimulated for 24-48 hours with 11 SARS-CoV-2 Spike peptide pools (17- or 18-mers with 11 amino acid overlap) (Genscript, Piscataway, NJ) at a concentration of 1μg/mL per peptide ...
-
bioRxiv - Biochemistry 2023Quote: ... and Ub-MCQ (Ub variant with an additional amino acid Cys between Met1 and Gln2) were constructed and cloned to the vector pET-22b by GenScript (Nanjing, China). The plasmids containing S ...
-
bioRxiv - Molecular Biology 2021Quote: Human langerin CRD WT and all mutants (amino acids 193-328) were cloned from a codon-optimized langerin gene for bacterial expression (GenScript, Piscataway, NJ, USA) into a pET-28a vector (GenScript ...
-
bioRxiv - Immunology 2022Quote: 15-mer peptides overlapping by 10 amino acids spanning the entire protein sequence of SARS-CoV-2 Spike were synthesized (GenScript; see Table S1). To stimulate whole blood or PBMC ...
-
bioRxiv - Biophysics 2022Quote: DNA fragments coding the C-terminal 350 amino acids of E6AP were synthesized as a codon-optimized artificial gene (GenScript, Piscataway, NJ, USA). The products were subsequently ligated into the pET28a vector with NdeI and BamHI restriction enzymes and designated E6APHECT_WT ...
-
bioRxiv - Biochemistry 2023Quote: ... The gene encoding for the GAF2 domain from All1280 of Nostoc PCC 7120 (NCBI protein ID BAB73237.1, UniProtKB Q8YXD3, amino acids 562-727) was ordered from Genscript (codon optimized for E. coli) in the pUC18 cloning vector ...
-
bioRxiv - Biophysics 2021Quote: ... lacking its amino-terminally signaling sequence within a pET28b-vector backbone yielding DegP with an amino-terminal His6-Tag (purchased from GenScript). The individual PDZ domains ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... N-biotinylated synthetic peptides (ctrl, pY, or Y816A; Genscript, USA, sequences described in figure 1h) of the last 26 amino acids (aa ...
-
bioRxiv - Cancer Biology 2023Quote: ... let-7 and miR-17-92 and ordered from GenScript Biotech ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by removal of trifluoroacetic acid (Genscript). When 100 μM of (PR)12 peptide and 0.5 mg/ml of poly-rA RNA were mixed ...
-
bioRxiv - Immunology 2022Quote: ... 7) TCRβ-CD3ε crosslinking: rabbit anti-V5 and mouse anti-HA (Genscript); 8 ...
-
bioRxiv - Biochemistry 2022Quote: The intein-7-140 α-syn fusion protein cDNA was synthesized by GenScript and inserted into a pT7-7 plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... The “i6×7” intron (GenBank: AF179904.1 nucleotide 2988 to 3740) was synthesized by Genscript. The K18JAX (originally named K18i6×7PA ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The plasmid encoding human CB2 with three amino-terminal HA-tags was custom-synthesized by GenScript (Rijswijk, Netherlands). The plasmids encoding human C5a1 ...
-
bioRxiv - Biochemistry 2019Quote: ... Synthetic human non-biotinylated HEG1 7-mer peptide (residues 1375–1381) was purchased from GenScript. His6-EGFP-KRIT1(WT ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Biophysics 2023Quote: The plasmid harboring wild-type Tsa1 (pET19b-Tsa1) was originally obtained with an amino-terminal deca-histidine-tag in a codon-optimized manner from GenScript (kind gift from P.O ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Each 7-mer D-peptide with an N-terminal cysteine was synthesized by GenScript (Piscataway, NJ). Peptides were conjugated with IRDye 800CW maleimide (Li-Cor ...
-
bioRxiv - Cancer Biology 2024Quote: ... Medium was collected 7 days post-transfection and mAbs were purified using protein A resin (Genscript) affinity chromatography and eluted in PBS (pH 7.4) ...
-
bioRxiv - Neuroscience 2024Quote: ... where the cysteine at position 29 was replaced by aspartic acid (Genscript). The synthesized constructs were injected into flies and targeted to attP1 or attP2 insertion sites on the second or third chromosomes respectively and the transgenic progeny were balanced either over CyO or TM6C (BestGene) ...
-
bioRxiv - Genetics 2020Quote: Primary anti-rabbit antibody against SYCE1 amino-terminal region (i.e. capable of detecting WT SYCE1 and its putative truncated form) was developed at GenScript (GenScript USA Inc.), using peptides ATRPQPLGMEPEGSC and CPEGARGQYGSTQKI from the amino-terminal region of the protein ...
-
bioRxiv - Cell Biology 2021Quote: ... (5) was synthesized by GenScript and subsequently subcloned into the respective restriction sites of pcDNA4/TO-CLC7-Y715C ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA (5’-UCGCUUGGUGCAGAUCGGGAC-3’) labeled at the 5’ end with FAM was synthesized by Genscript co. ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... were purchased from Santa Cruz Biotechnology (item sc-222407, sodium ursodeoxycholic acid, ≥98% purity) or synthesized by Genscript ((pyroE)WLGGRFamide ...
-
bioRxiv - Neuroscience 2023Quote: ... # E7) in 5% non-fat milk TBST and FOLR1 antibody in 5% non-fat milk TBST (GenScript). Anti-GFP antibody or normal rabbit IgG were used as controls in FOLR1-CD2AP co-IP experiments.
-
bioRxiv - Biochemistry 2022Quote: Recombinant mEAK-7 from Sus scrofa (uniprot ID: A0A4X1T484) was synthesized in a pET28 vector with N-terminal 6×His tag (GenScript). ArcticExpress competent cells (Agilent ...
-
bioRxiv - Cell Biology 2021Quote: ... which was synthesized to contain 7 modified TetO elements flanked by two minimal CMV promoter sequences based on pTet-T2 sequences (GenScript) (49) ...