Labshake search
Citations for GenScript :
51 - 100 of 1155 citations for 6H Dipyrido 3 2 b 2' 3' e 1 4 diazepin 6 one 11 ethyl 5 11 dihydro 8 2 hydroxyethyl 5 methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Microbiology 2023Quote: ... Human MARCH2 isoform 2 was identified from https://www.uniprot.org/uniprotkb/Q9P0N8/entry#Q9P0N8-1/2 and was acquired from GenScript, (clone ID ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The following gRNA sequence targeting ATF3 was cloned into plentiCRISPRv2 plasmid: 5’-CCACCGGATGTCCTCTGCGC-3’ (Genscript). HEK293FT cells were co-transfected with pLentiCRISPRv2-ATF3 CRISPR gRNA ...
-
bioRxiv - Biophysics 2022Quote: The full-length E-protein sequence from SARS-CoV-2 (GenBank Accession: NC_045512.2) was purchased from GenScript as a synthetic gene with optimized codon use for expression in Xenopus laevis ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... were codon optimized to S. coelicolor A3(2) using Genscript’s OptimumGene™ algorithm (Supplementary Fig. 5) and then synthesized by Genscript. The stop codon removed rAPOBEC1 was fused to the N-terminus of the start and stop codons removed Cas9n (D10A ...
-
bioRxiv - Biochemistry 2021Quote: ... Peptide-pulsing of target cells was performed by incubating EBV-LCLs in FBS-free medium at a density of 5×106 cells/ml for 2 hours in the presence of individual peptides (107 pg/ml, Genscript). After an overnight incubation ...
-
bioRxiv - Biochemistry 2021Quote: ... ATAD1 was diluted in 2-fold dilution series and incubated with 100 nM fluorescently-labeled peptide (P13: 5-FAM-FSRLYQLRIR, purchased from Genscript) for 20 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... and Omicron BA.5 spike were based on the codon-optimised spike sequence of SARS-CoV-2 and were generated by GenScript Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... and FAT-2 (Genscript) cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-Cy5-ACGCGUCGCAGGCCU UUUUAUU-3’; 0.3 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Microbiology 2021Quote: The ability of aptamers to block the association of SARS-COV-2 RBD with ACE-2 was measured with the cPass™ SARS-CoV-2 Neutralization Antibody Detection kit (GenScript®). For comparison ...
-
bioRxiv - Immunology 2023Quote: Lentiviral vectors for expression of SARS-CoV-2 spike (Delta variant B.1.617.2, NCBI accession # OX014251.1) were designed and synthesized from Genscript together with the two packaging plasmids (pMD2.G and psPAX2) ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... SARS-CoV-2 pseudovirus (Genscript) was diluted in DMEM complete media to an IFU of 3.2e7/mL ...
-
bioRxiv - Microbiology 2021Quote: ... ACE-2 –Fc (GenScript Z033484) was diluted at 1.2µg/ml in HBS P+ (Cytiva ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and 2 mL Protein A slurry (1 mL resin, GenScript) was deposited in the columns ...
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 (D614) and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Biophysics 2020Quote: ... Region +95 to +374 containing (linker-Spinach 2-linker-Spinach 2-linker) was synthesized by GenScript as double stranded DNA delivered on a pUC57 plasmid ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Systems Biology 2021Quote: ... and 2 were synthesized by Genscript. RTKs were cloned into MAC-TAG-C expression vector (Liu et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Angiopep-2 was obtained from GenScript. Puromycin dihydrochloride ...
-
bioRxiv - Immunology 2020Quote: ... Pseudotyped SARS-CoV-2-S (Genscript), full-length recombinant S protein (Acrobio systems) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the primers g11S/g11AS covering target site sequence 11 (Figure 1A; Supplementary table 1) were synthesized by Genscript (www.genscript.com.cn) and combined by annealing ...
-
bioRxiv - Immunology 2021Quote: ... respectively) were synthesized (Supplementary Table 11) and cloned into the expression vector pET22b (GenScript). An interchain disulfide (CαCys158–CβCys171 in RLQ3 ...
-
bioRxiv - Immunology 2022Quote: RMA-S/HLA-E cells were incubated with serial dilutions of peptides (3-300 μM, Genscript) in OptiMEM (ThermoFisher ...
-
bioRxiv - Biochemistry 2023Quote: ... A backbone vector containing the 3’ and 5’ segments of the Kv1.2 gene (including the UTR regions) in pUC57-Kan was ordered from Genscript. The final constructs were assembled using golden-gate cloning(52) ...
-
bioRxiv - Immunology 2021Quote: ... One million cells per well were added to a U-bottom 96-well plate and were stimulated with 5 μg/ml of pools of overlapping SARS-CoV-2 S protein peptides (GenScript USA Inc, Piscataway, NJ). The stimulation was performed by incubation for 6 h at 37°C and 5% CO2 in the presence of Protein Transport Inhibitor Cocktail (brefeldin A ...
-
bioRxiv - Immunology 2021Quote: Biotinylated SARS-CoV-2 S1 protein and biotinylated SARS-CoV-2 N protein were purchased from GenScript. The biotinylated proteins were combined with different streptavidin (SA ...
-
Oral delivery of SARS-CoV-2 DNA vaccines using attenuated Salmonella typhimurium as a carrier in ratbioRxiv - Microbiology 2020Quote: The pcDNA3.1(+)-CMV-SARS-CoV-2-S-GFP (pSARS-CoV-2-S) plasmid was purchased from Genscript Co. ...
-
bioRxiv - Microbiology 2022Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Cell Biology 2020Quote: ... Antagonist peptide 1 (SCSLFTCQNGIV) and 2 (SCSLFTCQNGGGWF) were chemically synthesized by Genscript. Anti-Mouse-IgG (H&L ...
-
bioRxiv - Biophysics 2022Quote: ... the coding sequence for the E protein from SARS-CoV-2 was initially codon optimized for Xenopus laevis and synthesized (GenScript, Piscataway, NJ). The gene was later modified for expression in HEK293 cells by adding a fluorescent EGFP tag ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Immunology 2019Quote: ... KHNYN-2 (NM_001290256) was synthesized by GenScript. KHNYN-1 was cloned by amplifying the nucleotides 123-2157 from KHNYN-2 and sub-cloning the PCR product into the pcDNA3.1 (+ ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 S was synthesized (Genscript) and cloned into pcDNA3.1 between two PmeI sites using NEBuilder ...
-
bioRxiv - Immunology 2021Quote: Purified SARS-CoV-2 S1 protein (GenScript) in carbonate buffer ...
-
bioRxiv - Immunology 2021Quote: Untagged SARS-CoV-2 spike protein (GenScript) containing the S1/S2 boundary furin site was coated onto the high protein binding ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL of reporter (1000 nM, GenScript Biotech Corporation ...
-
bioRxiv - Bioengineering 2023Quote: ... and KCGPQGIWGQCK (MMP-2 degradable peptide; GenScript) were used as crosslinkers in a 70:30 molar ratio respectively and were dissolved in 15 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP ...