Labshake search
Citations for GenScript :
51 - 100 of 178 citations for 6 ethoxybenzo b thiophen 3 2H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... SWR1C was eluted by nutating resin in 1 mL B-0.1 with 0.5 mg/mL recombinant 3xFlag peptide (Genscript) for 1 hour twice in series ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’-AATTCGGTCATGCCAGCGTA-3’) to target the mFoxO1gene and scrambled sgRNA (Sc-sgRNA) (5’-GCGAGGTATTCGGCTCCGCG-3’) were custom made by Genscript (Piscataway, NJ).
-
bioRxiv - Biochemistry 2021Quote: ... which contained an intact 3’UTR (GenScript, Piscataway, NJ). Two concentrations of Zfp36l1 (WT and mutant ...
-
bioRxiv - Microbiology 2021Quote: ... T1027I) and the B.1.526 lineage (L5F, T95I, D253G, E484K, D614G, A701V) were codon-optimized and synthesized by Genscript. The plasmids encoding the Spike from the B.1.617.1 (E154K ...
-
bioRxiv - Immunology 2021Quote: ... The SARS-CoV-2 S ectodomain with the 2P mutations and B.1.351 spike mutations (D80A, D215G, 242-244del, R246I, K417N, E484K, N501Y, D614G, and A701V) was synthesised by GenScript into pCMV with a C-terminal foldon and avi tag followed by an octa-histidine tag.
-
bioRxiv - Developmental Biology 2023Quote: ... or b) mRNA of either mCherry or GFP at 400ng/µl and ribonucleoprotein formed by Cas13a (GenScript, Piscataway, NJ) at 400 ng/µl and the corresponding targeting sgRNA at 400 ng/µl ...
-
bioRxiv - Developmental Biology 2020Quote: ... ID U3154EL200-3)27 or Tbx4-LME containing putative Tcf/Lef sites mutated (GenScript, ID U3154EL200-6) were synthesized and cloned into pGL4.23 (luc2/minP ...
-
bioRxiv - Molecular Biology 2023Quote: The 6-FAM-labeled and non-labeled RNA oligonucleotides were synthesized chemically by GenScript. The RNA annealing reaction containing 10 mM Tris-HCl (pH 7.4 at 25°C) ...
-
bioRxiv - Genetics 2023Quote: ... Identified homozygous PC-9_ EGFRdel19-ARTi clones were further engineered by cutting endogenous EGFR with a CRISPR all-in-one vector pX458_Exon20_gRNA TAGTCCAGGAGGCAGCCGAA (GenScript) using X-tremeGENE 9 DNA transfection reagent (Roche ...
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Supplementary Table 3) and synthesized in vitro (Genscript). For protein expression ...
-
bioRxiv - Neuroscience 2019Quote: ... control non-related target knockdown (5′-AGTGGATTCGAG-AGCGTGT-3′) (GenScript). To produce lentiviral particles ...
-
bioRxiv - Plant Biology 2022Quote: ... and AtNLP1-3 were codon-optimized and synthesized by Genscript, NJ ...
-
bioRxiv - Molecular Biology 2023Quote: ... All utrophin 3’UTR reporter constructs were generated by GenScript Biotech (Leiden ...
-
bioRxiv - Molecular Biology 2023Quote: The published DARPin TM-3 sequence22 was synthesized by GenScript and cloned into a pST50 expression vector27 with N-terminal 6x His tag using Gibson assembly ...
-
bioRxiv - Developmental Biology 2021Quote: ... The shRNA sequences were cloned into the RCAS vector (Supplementary Fig. 2A,B) by homologous recombination using a CloneEZ kit (GenScript) as previously described (Kwiatkowski et al. ...
-
bioRxiv - Immunology 2020Quote: ... Peptide-specific T cell lines were grown similarly using autologous irradiated BLCLs pulsed with 15-mers A3C-1 and A3C-B (GenScript).
-
bioRxiv - Molecular Biology 2024Quote: ... or LV1-eGFP-miR-7 were generated by subcloning inserts from pAAV_hSYN1-eGFP-miR-7 and pAAV_hSYN1-eGFP (provided by Thomas B. Hansen) inside LV1 (immunodeficiency virus 1 (HIV-1)-based LV-PGK-GFP) backbone by GenScript Biotech Corporation ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 and 6 wt% NorHA hydrogel precursor solutions containing 1 mM thiolated RGD (GCGYGRGDSPG, Genscript) and dithiothreitol (DTT ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... 3 gRNAs were designed around the SNPs and synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...
-
bioRxiv - Developmental Biology 2021Quote: ... flanked by duplicated copies of the 250bp chick B-globin HS4 insulator (Allen and Weeks, 2005; Rankin et al 2011) was commercially synthesized (Genscript USA) and cloned into the ApaI/XhoI sites of pBluescript II KS+ (Agilent 212207) ...
-
bioRxiv - Biophysics 2020Quote: ... LC3C/B) and the GFP-tagged double mutants (GFP-LC3A-EE, GFP-LC3B-AK) were obtained by subcloning (synthesized by GenScript, Piscataway, NJ).
-
bioRxiv - Molecular Biology 2020Quote: ... (referred to as eRF3 in the text) was made by inserting DNA between BglII and Nde1 sites of pET23(b) (GenScript, Piscataway, NJ).
-
bioRxiv - Bioengineering 2019Quote: ... and acetyl-CoA acetyltransferase/pyrophosphorylase (glmU, a homologue of gcaD in B. subtilis) were codon-optimized for Syn7002 and synthesized by GenScript (Hong Kong). The expression of both HA synthase genes was controlled by an IPTG inducible promotor ...
-
bioRxiv - Physiology 2023Quote: ... VHA was immunodetected using custom-made rabbit polyclonal antibodies against a highly conserved epitope within subunit B (epitope: AREEVPGRRGFPGY; GenScript, Piscataway, USA). Both NKA and VHA antibodies have been validated in the inner ear of splitnose rockfish (24 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pGEX4T-1-SUMO1-3 was designed by AJG and made by GenScript by cloning SUMO1-3 cDNA into BamHI and EcoR1 restriction sites ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Immunology 2021Quote: ... linked by a 6 aa linker and including a C-terminal HIS-tag were prepared by Genscript® (Piscataway ...
-
bioRxiv - Biochemistry 2023Quote: Five constructs (P2-6, Figure 1) were synthesised and cloned in to the pFastBAC1 vector by Genscript. The Mellitin signal sequence to direct secretion of the expressed protein (26 ...
-
bioRxiv - Immunology 2020Quote: ... with complete RPMI (10%FBS, 1% Pen/Strep, 50uM b-mercaptoethanol) supplemented with 1ug/ml OVA Peptide (323-339) (Genscript, Cat. No. RP10610) (DAY0) ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were incubated with primary antibody for one hour (α-CLuc; Santa-Cruz Biotech) at room temperature or overnight at 4°C (α-His; GenScript), followed by washes with TBS-T ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using polyethylenimine (PEI ...
-
bioRxiv - Genetics 2022Quote: The designed 3 pegRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: The 50-residue synthetic peptide used in Figure 3 was synthesized by GenScript USA Inc ...
-
bioRxiv - Biophysics 2022Quote: ... then synthesized and cloned into the pET26b(+) vector in frame with an C-terminal 6 × His tag (GenScript). BL21 DE3 cells were transformed with the plasmid and grown at 37°C in TB media supplemented with 1 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2024Quote: 5 µM STAT3136–705 (purified as described in 6) was incubated with 25µM phosphopeptides (Genscript, Piscataway, New Jersey) from the binding sites of gp130 (SGpYRHQVPSV) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-GCGUCGCAGGCCUUUUUAUU-3’; 0.39 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2022Quote: The previously designed 3 gRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... VHL 3KR-14-3-3ζ (1-230) 19KR K49E mutation were synthesized by GenScript Biotech ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA probes (Table S1) were synthesized and labeled with 6-FAM at the 5’ end by GenScript (Nanjing, China). For the RNA electrophoresis mobility shift assays (REMSAs) ...
-
bioRxiv - Immunology 2022Quote: ... 6 and 8 were analyzed with the cPass™ SARS-CoV- 2 neutralization antibody detection kit (GenScript, Cat #L00847) to detect any antibodies that neutralize the interaction between the RBDdelta and the ACE2 receptor ...
-
bioRxiv - Immunology 2023Quote: ... 5×105 cells per well (6 well plate) were stimulated with 100 ng/mL of IFN-γ (Z02916, Genscript) for 0 h ...
-
bioRxiv - Biochemistry 2022Quote: Recombinant mEAK-7 from Sus scrofa (uniprot ID: A0A4X1T484) was synthesized in a pET28 vector with N-terminal 6×His tag (GenScript). ArcticExpress competent cells (Agilent ...
-
bioRxiv - Molecular Biology 2020Quote: Codon optimized Gcn5 (S. pombe) with 1 × FLAG was cloned into pET28a in frame with N terminal 6 × HIS tag by GenScript to generate JP-2587.
-
bioRxiv - Immunology 2022Quote: The coding sequences for the extraviral domain of VARV A33 with N terminus 6×His tag and C-terminus Avi-tag were synthesized by GenScript and directly cloned into the PET-28a(+) ...