Labshake search
Citations for GenScript :
51 - 100 of 660 citations for 5 Isobutylcyclohexane 1 3 dione 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Biochemistry 2022Quote: ... Wells were washed 3 times in PBS and incubated with 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fluorogenic peptide cleavage assays were performed at 37 ° C with 1 μM coreAFG3L2WB or its variants and 50 uM peptide (Leu-(3-NO2-Tyr)-Phe-Gly-(Lys-Abz)) (GenScript) in a 384-well black plate using SpectraMax M5 plate reader (ex = 320 nm ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Immunology 2023Quote: ... were coated with 1 μg/mL (for IgG) or 5 μg/mL (for IgA) S-2P protein (GenScript), corresponding to the spike protein of the Wuhan-Hu-1 virus stabilized with 2 proline mutations ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Cell Biology 2021Quote: ... (5) was synthesized by GenScript and subsequently subcloned into the respective restriction sites of pcDNA4/TO-CLC7-Y715C ...
-
bioRxiv - Biochemistry 2021Quote: BiP-binding sites 1 and 3 were synthesized by Alan Scientific (Gaithersburg, MD) and site 2 was synthesized by Genscript (Piscataway, NJ). All peptides are N-terminally labeled with FITC via an amino hexanoic acid linker ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 5 peptides matching inoculum sequences for both the WT and SS14-DCKO strains (Table 3, labelled with a superscripted “1”) were produced by Genscript (Piscataway, NJ). Upon reception ...
-
bioRxiv - Genetics 2023Quote: ... every 1 μg RNA solution was ligated with 3 μl 25-μM poly(A)-ssRNA adaptor (pAGCUAAAAAAAAAAAAp, synthesized by GenScript Biotech Co.) at 16 °C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies were dissolved in 5% BSA (Biofroxx, 4240GR005) and the dilutions were: Streptavidin-HRP (1:2000, GenScript, M00091), RL2 (1:1000 ...
-
bioRxiv - Microbiology 2024Quote: ... followed by staining of cells with primary rabbit anti-SARS-CoV-2 N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Biochemistry 2021Quote: ... which contained an intact 3’UTR (GenScript, Piscataway, NJ). Two concentrations of Zfp36l1 (WT and mutant ...
-
bioRxiv - Neuroscience 2023Quote: ... # E7) in 5% non-fat milk TBST and FOLR1 antibody in 5% non-fat milk TBST (GenScript). Anti-GFP antibody or normal rabbit IgG were used as controls in FOLR1-CD2AP co-IP experiments.
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Supplementary Table 3) and synthesized in vitro (Genscript). For protein expression ...
-
bioRxiv - Plant Biology 2022Quote: ... and AtNLP1-3 were codon-optimized and synthesized by Genscript, NJ ...
-
bioRxiv - Molecular Biology 2023Quote: ... All utrophin 3’UTR reporter constructs were generated by GenScript Biotech (Leiden ...
-
bioRxiv - Molecular Biology 2023Quote: The published DARPin TM-3 sequence22 was synthesized by GenScript and cloned into a pST50 expression vector27 with N-terminal 6x His tag using Gibson assembly ...
-
bioRxiv - Biophysics 2020Quote: Mouse 5-HT3AR gene (purchased from GenScript) and mutant genes were inserted into pTLN plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... 3 gRNAs were designed around the SNPs and synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...
-
bioRxiv - Biophysics 2020Quote: ... Synthetic DNAs were purchased as GeneBlocks from IDT (5’ leader constructs) or as Gene Parts from GenScript (5’UTR constructs). All synthetic DNAs had a 5’-terminal XmaI consensus sequence and 3’-terminal HindIII consensus sequence ...
-
bioRxiv - Cell Biology 2023Quote: All peptides used for binding assays (Data S1) were synthesized with a N-terminal 5-carboxyfluorescien (5-FAM) at >85% purity (GenScript); peptides used for competition studies did not have 5-FAM ...
-
bioRxiv - Immunology 2019Quote: ... 5 µg/ml TSKB20 (ANYKFTLV) peptide (Genscript Inc.) or 50 ng/mL PMA plus 500 ng/ml ionomycin (Sigma ...
-
bioRxiv - Bioengineering 2023Quote: ... soluble RGD (5 mM RGD peptide, GCGYGRGDSPG, Genscript) was added to media in the 3% experimental group and outgrowth after 3 days was compared to PBS controls ...
-
bioRxiv - Immunology 2022Quote: ... binding of SARS-CoV2 and control IgG antibodies (at 1 µg/ml) to 15-mer S2 overlapping 5-amino acid peptides (n=52, GenScript Biotech, 500 ng/well) was tested using the same procedure as previously described (Wardemann ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Bioengineering 2021Quote: ... and 5 mM RGD peptide (Ac-RGDSPGERCG-NH2, Genscript) in PBS at a rates of 0.5 - 5 µL/min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using polyethylenimine (PEI ...
-
bioRxiv - Genetics 2022Quote: The designed 3 pegRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: The 50-residue synthetic peptide used in Figure 3 was synthesized by GenScript USA Inc ...
-
bioRxiv - Bioengineering 2022Quote: ... The rat Arc 5’ UTR sequence was synthesized by Genscript. Molecular cloning techniques (PCR amplification ...
-
bioRxiv - Cell Biology 2024Quote: ... The supernatant was mixed with 5×sample buffer (MB01015, GenScript), heated to 100°C for 8-10 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: The previously designed 3 gRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... The custom polyclonal p-Smurf2Thr249 antibody was generated (#J1683BA260-5) (GenScript). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... All AtLEA4-5 Scrambled ORFs were synthesized as gene fragments (Genscript).
-
bioRxiv - Evolutionary Biology 2022Quote: Protein G (5 μg/ml, 50 μl/well; Genscript, China, Z02007) was diluted to 5 μg/ml with PBS (0.01 M ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl synthetic antigen peptide (Genscript, 0.2 mg/ml in PBS), or 5 μl heat-killed bacteria in PBS ...
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and Solanum lycopersicum flavanone 3-hydroxylase (SlF3H) were optimized and synthesized by GenScript (Nanjing, China). Genes encoding Yarrowia lipolytica pentafunctional arom protein (YlARO1) ...